ID: 966240736

View in Genome Browser
Species Human (GRCh38)
Location 3:177752941-177752963
Sequence GCATGGACAGAATTACTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966240736_966240739 -7 Left 966240736 3:177752941-177752963 CCCAGCAGTAATTCTGTCCATGC No data
Right 966240739 3:177752957-177752979 TCCATGCAATTCTCTTGCATGGG No data
966240736_966240741 3 Left 966240736 3:177752941-177752963 CCCAGCAGTAATTCTGTCCATGC No data
Right 966240741 3:177752967-177752989 TCTCTTGCATGGGCTGTGACAGG No data
966240736_966240738 -8 Left 966240736 3:177752941-177752963 CCCAGCAGTAATTCTGTCCATGC No data
Right 966240738 3:177752956-177752978 GTCCATGCAATTCTCTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966240736 Original CRISPR GCATGGACAGAATTACTGCT GGG (reversed) Intergenic
No off target data available for this crispr