ID: 966241144

View in Genome Browser
Species Human (GRCh38)
Location 3:177756624-177756646
Sequence TGTGAATGCTGAGGGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966241144_966241149 4 Left 966241144 3:177756624-177756646 CCTGCAGCCCCTCAGCATTCACA No data
Right 966241149 3:177756651-177756673 TTATTTTACTCACTGGTATCTGG No data
966241144_966241148 -3 Left 966241144 3:177756624-177756646 CCTGCAGCCCCTCAGCATTCACA No data
Right 966241148 3:177756644-177756666 ACAGCTCTTATTTTACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966241144 Original CRISPR TGTGAATGCTGAGGGGCTGC AGG (reversed) Intergenic
No off target data available for this crispr