ID: 966243321

View in Genome Browser
Species Human (GRCh38)
Location 3:177778725-177778747
Sequence CATTCTCTACTGAAAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966243318_966243321 6 Left 966243318 3:177778696-177778718 CCTAGTACTCAGATTTTGTCCTC No data
Right 966243321 3:177778725-177778747 CATTCTCTACTGAAAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966243321 Original CRISPR CATTCTCTACTGAAAGAACA AGG Intergenic
No off target data available for this crispr