ID: 966255696

View in Genome Browser
Species Human (GRCh38)
Location 3:177914422-177914444
Sequence GCCGCCCTGTCTGGAAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19780
Summary {0: 10, 1: 115, 2: 2447, 3: 6594, 4: 10614}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966255696_966255701 12 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255701 3:177914457-177914479 GTGCTCCTCACTTGCCAGATGGG No data
966255696_966255704 24 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG No data
966255696_966255706 30 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255706 3:177914475-177914497 ATGGGGCAGCAGCCAGGCAGAGG No data
966255696_966255698 -10 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255698 3:177914435-177914457 ACAGGGCGGCAGCCAGAGAGAGG No data
966255696_966255702 13 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255702 3:177914458-177914480 TGCTCCTCACTTGCCAGATGGGG No data
966255696_966255700 11 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255700 3:177914456-177914478 GGTGCTCCTCACTTGCCAGATGG 0: 2
1: 154
2: 1790
3: 10452
4: 6714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966255696 Original CRISPR GCCGCCCTGTCTGGAAAGTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr