ID: 966255697

View in Genome Browser
Species Human (GRCh38)
Location 3:177914431-177914453
Sequence TCTCTGGCTGCCGCCCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966255697_966255704 15 Left 966255697 3:177914431-177914453 CCAGACAGGGCGGCAGCCAGAGA No data
Right 966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG No data
966255697_966255700 2 Left 966255697 3:177914431-177914453 CCAGACAGGGCGGCAGCCAGAGA No data
Right 966255700 3:177914456-177914478 GGTGCTCCTCACTTGCCAGATGG 0: 2
1: 154
2: 1790
3: 10452
4: 6714
966255697_966255701 3 Left 966255697 3:177914431-177914453 CCAGACAGGGCGGCAGCCAGAGA No data
Right 966255701 3:177914457-177914479 GTGCTCCTCACTTGCCAGATGGG No data
966255697_966255702 4 Left 966255697 3:177914431-177914453 CCAGACAGGGCGGCAGCCAGAGA No data
Right 966255702 3:177914458-177914480 TGCTCCTCACTTGCCAGATGGGG No data
966255697_966255706 21 Left 966255697 3:177914431-177914453 CCAGACAGGGCGGCAGCCAGAGA No data
Right 966255706 3:177914475-177914497 ATGGGGCAGCAGCCAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966255697 Original CRISPR TCTCTGGCTGCCGCCCTGTC TGG (reversed) Intergenic
No off target data available for this crispr