ID: 966255699

View in Genome Browser
Species Human (GRCh38)
Location 3:177914447-177914469
Sequence AAGTGAGGAGCACCTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966255699_966255709 29 Left 966255699 3:177914447-177914469 CCAGAGAGAGGTGCTCCTCACTT No data
Right 966255709 3:177914499-177914521 ACTCCTCATTTGCTAGATGGTGG No data
966255699_966255706 5 Left 966255699 3:177914447-177914469 CCAGAGAGAGGTGCTCCTCACTT No data
Right 966255706 3:177914475-177914497 ATGGGGCAGCAGCCAGGCAGAGG No data
966255699_966255704 -1 Left 966255699 3:177914447-177914469 CCAGAGAGAGGTGCTCCTCACTT No data
Right 966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG No data
966255699_966255710 30 Left 966255699 3:177914447-177914469 CCAGAGAGAGGTGCTCCTCACTT No data
Right 966255710 3:177914500-177914522 CTCCTCATTTGCTAGATGGTGGG No data
966255699_966255708 26 Left 966255699 3:177914447-177914469 CCAGAGAGAGGTGCTCCTCACTT No data
Right 966255708 3:177914496-177914518 GGCACTCCTCATTTGCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966255699 Original CRISPR AAGTGAGGAGCACCTCTCTC TGG (reversed) Intergenic
No off target data available for this crispr