ID: 966255704

View in Genome Browser
Species Human (GRCh38)
Location 3:177914469-177914491
Sequence TGCCAGATGGGGCAGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966255697_966255704 15 Left 966255697 3:177914431-177914453 CCAGACAGGGCGGCAGCCAGAGA No data
Right 966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG No data
966255696_966255704 24 Left 966255696 3:177914422-177914444 CCTCACTTTCCAGACAGGGCGGC 0: 10
1: 115
2: 2447
3: 6594
4: 10614
Right 966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG No data
966255699_966255704 -1 Left 966255699 3:177914447-177914469 CCAGAGAGAGGTGCTCCTCACTT No data
Right 966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966255704 Original CRISPR TGCCAGATGGGGCAGCAGCC AGG Intergenic
No off target data available for this crispr