ID: 966258714

View in Genome Browser
Species Human (GRCh38)
Location 3:177949959-177949981
Sequence AAAGCTTCTTGAAACCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966258714_966258717 1 Left 966258714 3:177949959-177949981 CCCACATGGTTTCAAGAAGCTTT No data
Right 966258717 3:177949983-177950005 TTTTGTAAGCGTGTCCCTGAGGG No data
966258714_966258720 26 Left 966258714 3:177949959-177949981 CCCACATGGTTTCAAGAAGCTTT No data
Right 966258720 3:177950008-177950030 GTTTATTTATATCAGCAAGCAGG No data
966258714_966258716 0 Left 966258714 3:177949959-177949981 CCCACATGGTTTCAAGAAGCTTT No data
Right 966258716 3:177949982-177950004 ATTTTGTAAGCGTGTCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966258714 Original CRISPR AAAGCTTCTTGAAACCATGT GGG (reversed) Intergenic
No off target data available for this crispr