ID: 966270796

View in Genome Browser
Species Human (GRCh38)
Location 3:178103191-178103213
Sequence TCCTGTGTAGGAGGGACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966270796_966270801 7 Left 966270796 3:178103191-178103213 CCATATGTCCCTCCTACACAGGA No data
Right 966270801 3:178103221-178103243 GCTCTACAAAGTCAGTCCTCTGG No data
966270796_966270803 27 Left 966270796 3:178103191-178103213 CCATATGTCCCTCCTACACAGGA No data
Right 966270803 3:178103241-178103263 TGGACCTCAGTAGCAGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966270796 Original CRISPR TCCTGTGTAGGAGGGACATA TGG (reversed) Intergenic
No off target data available for this crispr