ID: 966275552

View in Genome Browser
Species Human (GRCh38)
Location 3:178161734-178161756
Sequence GAATGACAGCAATCACATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966275549_966275552 4 Left 966275549 3:178161707-178161729 CCAGGAAATTATATAGATAAGTG No data
Right 966275552 3:178161734-178161756 GAATGACAGCAATCACATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966275552 Original CRISPR GAATGACAGCAATCACATAA GGG Intergenic
No off target data available for this crispr