ID: 966275809

View in Genome Browser
Species Human (GRCh38)
Location 3:178166897-178166919
Sequence CTTTTTATCCTGAAGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966275809_966275814 25 Left 966275809 3:178166897-178166919 CCAACACCCTTCAGGATAAAAAG No data
Right 966275814 3:178166945-178166967 AAAATACCTCAACATAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966275809 Original CRISPR CTTTTTATCCTGAAGGGTGT TGG (reversed) Intergenic
No off target data available for this crispr