ID: 966275809 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:178166897-178166919 |
Sequence | CTTTTTATCCTGAAGGGTGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
966275809_966275814 | 25 | Left | 966275809 | 3:178166897-178166919 | CCAACACCCTTCAGGATAAAAAG | No data | ||
Right | 966275814 | 3:178166945-178166967 | AAAATACCTCAACATAATAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
966275809 | Original CRISPR | CTTTTTATCCTGAAGGGTGT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |