ID: 966275814

View in Genome Browser
Species Human (GRCh38)
Location 3:178166945-178166967
Sequence AAAATACCTCAACATAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966275813_966275814 1 Left 966275813 3:178166921-178166943 CCTAAAAAAACTGTGTATATGAG No data
Right 966275814 3:178166945-178166967 AAAATACCTCAACATAATAGAGG No data
966275809_966275814 25 Left 966275809 3:178166897-178166919 CCAACACCCTTCAGGATAAAAAG No data
Right 966275814 3:178166945-178166967 AAAATACCTCAACATAATAGAGG No data
966275810_966275814 19 Left 966275810 3:178166903-178166925 CCCTTCAGGATAAAAAGCCCTAA No data
Right 966275814 3:178166945-178166967 AAAATACCTCAACATAATAGAGG No data
966275811_966275814 18 Left 966275811 3:178166904-178166926 CCTTCAGGATAAAAAGCCCTAAA No data
Right 966275814 3:178166945-178166967 AAAATACCTCAACATAATAGAGG No data
966275812_966275814 2 Left 966275812 3:178166920-178166942 CCCTAAAAAAACTGTGTATATGA No data
Right 966275814 3:178166945-178166967 AAAATACCTCAACATAATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966275814 Original CRISPR AAAATACCTCAACATAATAG AGG Intergenic
No off target data available for this crispr