ID: 966288531

View in Genome Browser
Species Human (GRCh38)
Location 3:178326686-178326708
Sequence CTGAAGGAAGGGTGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966288531_966288540 24 Left 966288531 3:178326686-178326708 CCTATTTCCCACCCTTCCTTCAG No data
Right 966288540 3:178326733-178326755 ACCTCTTCACTACTTGGGCAAGG No data
966288531_966288538 18 Left 966288531 3:178326686-178326708 CCTATTTCCCACCCTTCCTTCAG No data
Right 966288538 3:178326727-178326749 GACTTCACCTCTTCACTACTTGG No data
966288531_966288539 19 Left 966288531 3:178326686-178326708 CCTATTTCCCACCCTTCCTTCAG No data
Right 966288539 3:178326728-178326750 ACTTCACCTCTTCACTACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966288531 Original CRISPR CTGAAGGAAGGGTGGGAAAT AGG (reversed) Intergenic
No off target data available for this crispr