ID: 966293511

View in Genome Browser
Species Human (GRCh38)
Location 3:178388676-178388698
Sequence GACTGAGTTCCGCTTTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966293509_966293511 -2 Left 966293509 3:178388655-178388677 CCTTTGCCAATGGAGTTAAAGGA No data
Right 966293511 3:178388676-178388698 GACTGAGTTCCGCTTTTGTCTGG No data
966293506_966293511 24 Left 966293506 3:178388629-178388651 CCTCTTTGCTAAGGACTGAGGGA No data
Right 966293511 3:178388676-178388698 GACTGAGTTCCGCTTTTGTCTGG No data
966293510_966293511 -8 Left 966293510 3:178388661-178388683 CCAATGGAGTTAAAGGACTGAGT No data
Right 966293511 3:178388676-178388698 GACTGAGTTCCGCTTTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966293511 Original CRISPR GACTGAGTTCCGCTTTTGTC TGG Intergenic
No off target data available for this crispr