ID: 966296999

View in Genome Browser
Species Human (GRCh38)
Location 3:178435651-178435673
Sequence TGCTTCTCATGTCAGCACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1213
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 1177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966296993_966296999 29 Left 966296993 3:178435599-178435621 CCCTAGAAAGGGATCTGTGGCTC 0: 1
1: 0
2: 0
3: 19
4: 141
Right 966296999 3:178435651-178435673 TGCTTCTCATGTCAGCACTATGG 0: 1
1: 0
2: 1
3: 34
4: 1177
966296994_966296999 28 Left 966296994 3:178435600-178435622 CCTAGAAAGGGATCTGTGGCTCT 0: 1
1: 0
2: 0
3: 21
4: 209
Right 966296999 3:178435651-178435673 TGCTTCTCATGTCAGCACTATGG 0: 1
1: 0
2: 1
3: 34
4: 1177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966296999 Original CRISPR TGCTTCTCATGTCAGCACTA TGG Intronic
900274314 1:1813749-1813771 TGCCTCTCATCCCAGCACTTTGG - Intronic
900712721 1:4124693-4124715 TGCCTGTCATCTCAGCACTTTGG - Intergenic
901111176 1:6797319-6797341 TGCTTGTCATCCCAGCACTTTGG - Intronic
901247421 1:7743622-7743644 TGCTTCTCCTGCCAACACGAAGG - Intronic
901296018 1:8161477-8161499 TGCCTCTAATCTCAGCACTTTGG - Intergenic
902221025 1:14965278-14965300 TGCTTGTAATCTCAGCACTTTGG - Intronic
903010698 1:20328087-20328109 AGCTTCTGAGGCCAGCACTAGGG - Intronic
903145140 1:21367021-21367043 TGCCTCTAATCTCAGCACTTTGG + Intergenic
903248504 1:22034671-22034693 TGCTTGTCATCCCAGCACTTTGG + Intergenic
903249273 1:22040745-22040767 TGCTTCTAATCCCAGCACTTTGG + Intergenic
903444686 1:23414659-23414681 TGCTTGTAATTTCAGCACTTTGG - Intronic
903524642 1:23983867-23983889 TGCTTGTAATGCCAGCACTTCGG - Intergenic
903534114 1:24055383-24055405 TGCCTCTAATCTCAGCACTTTGG + Intergenic
903667416 1:25016591-25016613 GGCTTCTCATTTCCGCACTGTGG + Intergenic
903945146 1:26958074-26958096 TGCCTGTAATGTCAGCACTTTGG - Intronic
903949173 1:26984661-26984683 TGCTTGTAATCTCAGCACTTTGG - Intergenic
904682304 1:32237806-32237828 TGCCTGTCATCTCAGCACTTTGG - Intergenic
904692594 1:32304970-32304992 TGCTTATAATCTCAGCACTTTGG - Intronic
904730345 1:32586055-32586077 TGCCTGTAATGTCAGCACTTTGG + Intronic
904746580 1:32715230-32715252 TGCCTCTCATCCCAGCACTTTGG - Intergenic
904777358 1:32918845-32918867 TGCTTGTAATCTCAGCACTTTGG - Intergenic
904830252 1:33301818-33301840 TGCTTGTAATCTCAGCACTTTGG + Intergenic
905099247 1:35504144-35504166 TGCCTGTAATGTCAGCACTGGGG - Intronic
905411519 1:37772857-37772879 TGCTTATAATCTCAGCACTTTGG - Intergenic
905411623 1:37773693-37773715 TGCTTGTAATCTCAGCACTTTGG + Intergenic
905575789 1:39043641-39043663 TGGTTTACATGTCAGCATTATGG + Intergenic
905615784 1:39397299-39397321 TGCCTGTCATCTCAGCACTTTGG + Intronic
905728349 1:40275157-40275179 TGCTTGTAATCTCAGCACTTGGG + Intronic
906341289 1:44983172-44983194 TGCCTCTAATCTCAGCACTTTGG - Intronic
906393662 1:45441566-45441588 TGCTTGTAATCTCAGCACTTTGG - Intronic
906534065 1:46541834-46541856 TGCTTGTCATCCCAGCACTTTGG - Intergenic
906629604 1:47355304-47355326 TGCTTGTAATCTCAGCACTTTGG - Intronic
906985763 1:50681777-50681799 TGCTTGTAATGCCAGCACTTTGG - Intronic
907233296 1:53021267-53021289 TGCCTGTCATCTCAGCACTTTGG - Intronic
907365964 1:53960158-53960180 TGCTTGTAATGTCAGCACTTTGG - Intronic
907468721 1:54657308-54657330 TGCTTGTAATCTCAGCACTTTGG - Intronic
908176797 1:61564058-61564080 TGCTTATAATCTCAGTACTATGG + Intergenic
908674352 1:66585748-66585770 TGCTTGTAATCTCAGCACTTTGG - Intronic
909105129 1:71397585-71397607 TGCTTGTAATCTCAGCACTTTGG - Exonic
910218795 1:84868368-84868390 TGCTTGTAATCTCAGCACTTTGG - Intronic
910478219 1:87631514-87631536 TGCTTCTAATCCCAGCACTTCGG + Intergenic
910951147 1:92649553-92649575 TGCTTGTAATCTCAGCACTTTGG + Intronic
910964700 1:92796716-92796738 TGCTTGTAATCTCAGCACTTTGG - Intergenic
911279156 1:95901258-95901280 TGCTCCTCATGTCTTCACTCTGG - Intergenic
911828414 1:102518037-102518059 TGCTTCTAATCCCAGCACTTTGG - Intergenic
912934593 1:113992218-113992240 TGCTTGTAATGCCAGCACTTTGG - Intergenic
913006634 1:114639318-114639340 TGCTTGTAATCTCAGCACTTCGG + Intronic
913296469 1:117326097-117326119 TGCTTGTAATCTCAGCACTTTGG + Intergenic
914715731 1:150253508-150253530 TGCTTATAATCTCAGCACTTTGG + Intergenic
915183583 1:154084470-154084492 TGCTTCTAATCCCAGCACTTTGG - Intronic
915211821 1:154315331-154315353 TGCTTGTAATCTCAGCACTTTGG + Intergenic
915231683 1:154450382-154450404 TGCCTGTAATGTCAGCACTTTGG - Intronic
915394215 1:155569695-155569717 TGCTTGTAATCTCAGCACTTTGG - Intergenic
915413272 1:155719805-155719827 TGCCTGTCATCCCAGCACTATGG - Intronic
915454312 1:156029222-156029244 TGCCTGTCATCTCAGCACTTTGG - Intergenic
915679536 1:157567147-157567169 TGCTTGTAATCTCAGCACTTTGG - Intergenic
915753055 1:158229727-158229749 TGCTTGTAATCTCAGCACTTTGG - Intergenic
916101354 1:161395861-161395883 TGCTTATAATCTCAGCACTTTGG + Intergenic
916177001 1:162050238-162050260 TGCTTGTAATCTCAGCACTTTGG - Intergenic
916250002 1:162728740-162728762 TGTTTATCATGTGATCACTAGGG - Intronic
916914935 1:169396291-169396313 TGCCTCTAATCTCAGCACTTTGG + Intronic
917085735 1:171304507-171304529 TGCCTGTAATGTCAGCACTTTGG + Intergenic
917289068 1:173453523-173453545 TGCCTGTCATCTCAGCACTTCGG - Intergenic
917669703 1:177261764-177261786 TGCTTCACAACTCAGCCCTAGGG - Intronic
917874640 1:179274979-179275001 TGCATATCATCTCAGCACTTTGG + Intergenic
917922208 1:179759925-179759947 TGCCTGTAATGTCAGCACTTTGG - Intronic
919028057 1:192202658-192202680 TGCCTGTCATCTCAGCACTTTGG + Intergenic
919233168 1:194802460-194802482 CACTTCTCTTGCCAGCACTAAGG - Intergenic
919458423 1:197847172-197847194 TGCTTGTAATCTCAGCACTTCGG + Intergenic
919918139 1:202151775-202151797 TGCTTATAATCTCAGCACTTTGG - Intronic
920161780 1:204004180-204004202 TGCTTGTAATCTCAGCACTTTGG + Intergenic
920454980 1:206093937-206093959 TGCTTGTAATCTCAGCACTTTGG - Intronic
920655525 1:207871539-207871561 TGCCTGTAATCTCAGCACTATGG - Intergenic
920765018 1:208823936-208823958 TGCTTGTAATCTCAGCACTTTGG + Intergenic
920820184 1:209373297-209373319 TGCTTCTCTTGGGAGCAATAAGG - Intergenic
920881810 1:209887629-209887651 TGCCTGTAATGTCAGCACTTTGG - Intergenic
921122026 1:212145627-212145649 TGCCTCTAATCTCAGCACTTGGG - Intergenic
921861889 1:220049369-220049391 TGCTGGTAATGTCAGCACTTTGG + Intergenic
922539097 1:226405564-226405586 TGCTTGTAATCTCAGCACTTTGG - Intronic
922624913 1:227029872-227029894 TGCTTATAATCTCAGCACTTTGG + Intronic
922640134 1:227221952-227221974 TGCTTATAATCTCAGCACTTTGG + Intronic
923418594 1:233790072-233790094 TCCCTCACATCTCAGCACTATGG + Intergenic
923637941 1:235719915-235719937 TGCCTGTCATCTCAGCACTTTGG + Intronic
923982474 1:239340817-239340839 TTCTTCTCCTTTCAGCCCTAAGG + Intergenic
924104691 1:240638402-240638424 TGCTTGTAATCTCAGCACTTTGG - Intergenic
924394452 1:243604153-243604175 TGCTTGGAATCTCAGCACTATGG - Intronic
924465628 1:244296863-244296885 TGCTTGTAATCTCAGCACTTTGG + Intergenic
924472694 1:244357180-244357202 TGCCTGTCATCTCAGCACTTTGG - Intronic
924493353 1:244561889-244561911 CGCTTCTAATGCCAGCACTTTGG + Intronic
924528129 1:244869881-244869903 TGCTTATAATCTCAGCACTTTGG - Intergenic
1062780472 10:200535-200557 TGCTTGTAATCTCAGCACTTTGG - Intronic
1064533584 10:16334979-16335001 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1064543089 10:16424840-16424862 TGCCTGTCATCTCAGCACTCTGG - Intergenic
1064678577 10:17786482-17786504 TGCTTGTAATCTCAGCACTTTGG - Intronic
1064681277 10:17812829-17812851 TGCCTGTAATGTCAGCACTTTGG - Intronic
1064720233 10:18221416-18221438 TGCTGGTCATGCCAGCACTTTGG + Intronic
1065457139 10:25918489-25918511 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1065547636 10:26837873-26837895 TGCCTCTAATCTCAGCACTTTGG - Intronic
1065743559 10:28818215-28818237 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1065745490 10:28837401-28837423 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1066236343 10:33488627-33488649 TGCTTGTAATCTCAGCACTCTGG - Intergenic
1066290480 10:34009937-34009959 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1066368951 10:34803528-34803550 TGCCTGTCATCTCAGCACTTTGG + Intronic
1066636374 10:37505852-37505874 TGCTTATAATCTCAGCACTTTGG + Intergenic
1066990050 10:42504729-42504751 TGGTTCTCACGGCAGCCCTAAGG + Intergenic
1067466918 10:46507570-46507592 TGCCTCTAATGCCAGCACTTTGG - Intergenic
1067486617 10:46656578-46656600 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1067608134 10:47685084-47685106 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1067620268 10:47877035-47877057 TGCCTCTAATGCCAGCACTTTGG + Intergenic
1067756243 10:49008049-49008071 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1067937974 10:50626898-50626920 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1068176224 10:53462711-53462733 CGCCTCTCATCTCAGCACTTTGG - Intergenic
1068392422 10:56415191-56415213 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1068750220 10:60583842-60583864 TGCCTGTAATGTCAGCACTTTGG - Intronic
1068888851 10:62127261-62127283 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1069450040 10:68509830-68509852 TGCTTCTAATCCCAGCACTTTGG + Intronic
1070142452 10:73748393-73748415 TGCCTGTAATGTCAGCACTTTGG - Intronic
1070308189 10:75252577-75252599 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1070770340 10:79078808-79078830 TGCTTGTAATCCCAGCACTATGG - Intronic
1071222845 10:83489716-83489738 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1071548974 10:86551469-86551491 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1071623731 10:87146794-87146816 TGCCTCTAATCTCAGCACTTTGG + Intronic
1072114697 10:92359077-92359099 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1072119062 10:92390286-92390308 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1072162377 10:92780691-92780713 TGCTTATAATCCCAGCACTATGG + Intergenic
1072235119 10:93446975-93446997 TGCCTGTGATGTCAGCACTTTGG - Intronic
1072248719 10:93565438-93565460 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1072321854 10:94258223-94258245 TGCTTATAATCTCAGCACTTTGG - Intronic
1072411613 10:95207847-95207869 TGCTTGCAATGTCAGCACTTCGG + Intronic
1072891967 10:99331604-99331626 TGCTTCTAATCCCAGCACTTTGG + Intronic
1073109353 10:101051702-101051724 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1073237274 10:102028286-102028308 TGCTTATAATCTCAGCACTTTGG + Intronic
1073274526 10:102298191-102298213 TGCTTGTAATCTCAGCACTTTGG - Intronic
1073308890 10:102525368-102525390 TGCTTATAATCTCAGCACTTTGG - Intronic
1073682092 10:105715894-105715916 TGCCTGTCATTTCAGCACTTTGG - Intergenic
1074144585 10:110705818-110705840 TGCTTCTAATCCCAGCACTTTGG + Intronic
1074475631 10:113771411-113771433 TGCTTGTAATCTCAGCACTTTGG + Intronic
1074820897 10:117177662-117177684 TGCTTCTAATCCCAGCACTTTGG - Intergenic
1075358964 10:121812214-121812236 TGCCTGTAATGTCAGCACTTTGG - Intronic
1075363591 10:121862632-121862654 TGCTTGTAATCTCAGCACTTTGG - Intronic
1075393084 10:122107272-122107294 TGCTTCTAATCCCAGCACTTTGG + Intronic
1075407547 10:122204573-122204595 TGCCTGTCATCTCAGCACTTTGG + Intronic
1075696718 10:124441455-124441477 TGCCTGTCATGTCATCACTTTGG - Intergenic
1075817318 10:125274669-125274691 TGCCTCTCATCCCAGCACTTTGG - Intergenic
1075836233 10:125455109-125455131 TGGTTCTGATCTAAGCACTATGG - Intergenic
1076177063 10:128376416-128376438 TTCTTCACATGGCAGCAGTAAGG + Intergenic
1076185840 10:128448121-128448143 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1077623650 11:3750894-3750916 TGCTTCTAATCCCAGCACTTTGG - Intronic
1078149327 11:8745313-8745335 TGCCTCTAATGCCAGCACTTGGG - Intronic
1078267632 11:9766756-9766778 TGCTCCTGAAGTCAGCACCAGGG + Intergenic
1078801867 11:14653736-14653758 TGCTTGTAATCTCAGCACTTTGG + Intronic
1079212693 11:18477196-18477218 TGCCTCTAATCTCAGCACTTTGG + Intronic
1079322990 11:19467777-19467799 TGCAGCTCTTGTCAGAACTAAGG - Intronic
1079556054 11:21760063-21760085 TTCTTCACATGGCAGCAGTAAGG + Intergenic
1079802472 11:24887623-24887645 ACTTTCTCATGTCAGAACTAGGG - Intronic
1080454925 11:32409704-32409726 TGCTTGTAATCTCAGCACTTTGG - Intronic
1080658973 11:34280553-34280575 TGCTTATTATGTTAGCAGTAGGG - Intronic
1081136746 11:39449082-39449104 TTCTTCACATGGCAGCACCAAGG + Intergenic
1081504935 11:43706281-43706303 TGCCTCTAATCTCAGCACTTTGG + Intronic
1081935039 11:46898444-46898466 TGCTTATAATGCCAGCACTTTGG - Intronic
1082754186 11:57056379-57056401 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1082859554 11:57841653-57841675 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1083090684 11:60196975-60196997 TGCTTCTAATCCCAGCACTTTGG + Intergenic
1083181047 11:60985695-60985717 TGCCTGTCATGCCAGCACTTTGG + Intronic
1083233572 11:61338191-61338213 TGCACTTCATGGCAGCACTAAGG - Intronic
1083338044 11:61938663-61938685 TGCTTCTAATCCCAGCACTTTGG + Intergenic
1083371236 11:62183497-62183519 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1084115481 11:67040577-67040599 TGCCTCTAATCTCAGCACTTTGG + Intronic
1084681871 11:70671030-70671052 TGCTTATCATGTTAGCAATGAGG - Intronic
1084926555 11:72517703-72517725 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1084996502 11:72984848-72984870 TGCTTCTCAAGACTGCATTAGGG - Intronic
1085484747 11:76852572-76852594 TGCTTGTAATCTCAGCACTTCGG - Intergenic
1085590769 11:77757873-77757895 TGCTTGTAATCTCAGCACTCTGG + Intronic
1085594903 11:77800607-77800629 TGCCTGTCATCTCAGCACTTTGG + Intronic
1086339401 11:85832728-85832750 TGCTTCTAATCTCAGCAGTTTGG + Intergenic
1086680408 11:89664000-89664022 CGCTTCTAATCTCAGCACTTTGG + Intergenic
1087568160 11:99889805-99889827 TGCTTCTAATCCCAGCACTCTGG - Intronic
1087629004 11:100628513-100628535 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1087757421 11:102069540-102069562 TGCTTGTAATCTCAGCACTTTGG + Intronic
1087772046 11:102221461-102221483 TGCTTGTAATGCCAGCACTTTGG + Intronic
1087915505 11:103805069-103805091 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1088127249 11:106443359-106443381 TGCTTCTAATGCTATCACTAAGG - Intergenic
1088275754 11:108083528-108083550 TGCCTGTCATCTCAGCACTTTGG + Intronic
1088328211 11:108623767-108623789 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1088371941 11:109100076-109100098 TGCTTTTCATGTGGGCACTCAGG - Intergenic
1088400670 11:109420376-109420398 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1088768816 11:113012558-113012580 TGCTTCCCTTGACAGCTCTAGGG + Intronic
1089153115 11:116379624-116379646 AGCTTCCCAGGTCAGCACCATGG - Intergenic
1089304761 11:117519557-117519579 TGCTTGTAATCTCAGCACTCTGG + Intronic
1089504162 11:118952377-118952399 TGCCTGTCATCTCAGCACTTTGG - Intronic
1089731026 11:120518876-120518898 TGCCTATAATGTCAGCACTTTGG - Intronic
1089935000 11:122355365-122355387 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1090714490 11:129418232-129418254 TGCTTCTCATGTGGTCAATAAGG + Intronic
1090793323 11:130111528-130111550 TGCTTCTGATGGCAGCAAAATGG + Intronic
1090931777 11:131304223-131304245 TACTTCTCAGCTCAGCACTGTGG + Intergenic
1091174703 11:133547539-133547561 TACTCCTCATGGCAGCACTGTGG - Intergenic
1091420750 12:337901-337923 TGCTTGTAATCTCAGCACTTTGG - Intronic
1091633365 12:2178799-2178821 TGCTTTTAATCTCAGCACTTTGG + Intronic
1091726639 12:2850930-2850952 TGCTTGTAATCTCAGCACTTTGG - Intronic
1092144808 12:6207257-6207279 TGCTTCTTATGGCAGAAATATGG - Intronic
1092387113 12:8044312-8044334 TGCCTGTAATGTCAGCACTTTGG + Intronic
1092420894 12:8330893-8330915 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1092482763 12:8875336-8875358 TGCTTGTAATCTCAGCACTTTGG - Intronic
1092522757 12:9290833-9290855 CGCCTGTCATCTCAGCACTATGG - Intergenic
1092544529 12:9441064-9441086 CGCCTGTCATCTCAGCACTATGG + Intergenic
1092601662 12:10072816-10072838 TGCTTGTAATCTCAGCACTTTGG + Intronic
1092668062 12:10828902-10828924 TGCCTGTCATTTCAGCACTTTGG + Intronic
1092823364 12:12374370-12374392 TGCTTCTAATTCCAGCACTTTGG + Intronic
1092823973 12:12379751-12379773 AACTTTTTATGTCAGCACTAGGG + Intronic
1092832786 12:12461430-12461452 TGCTTGTCATCTCAGTACTTTGG - Intronic
1092846260 12:12588058-12588080 TGCCTGTCATGCCAGCACTTTGG - Intergenic
1092862153 12:12727858-12727880 TGCCTGTCATCTCAGCACTTTGG - Intronic
1092909322 12:13132579-13132601 TGCTTGTAATGCCAGCACTTTGG + Intronic
1093040123 12:14369211-14369233 TGCTTGTAATCTCAGCACTTTGG - Intronic
1093742585 12:22705339-22705361 TGCTCATCATGTTAGCCCTAGGG - Intergenic
1094508423 12:31081003-31081025 TGCCTGTAATCTCAGCACTATGG - Intronic
1094824441 12:34258357-34258379 TGCTTCTCATCCCAGCATTTTGG - Intergenic
1095091501 12:38111645-38111667 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1095204853 12:39427917-39427939 TGCTTGTAATCTCAGCACTTTGG - Intronic
1095406979 12:41877704-41877726 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1095456564 12:42391954-42391976 TGCTTGTAATCTCAGCACTTTGG + Intronic
1095763656 12:45869620-45869642 TGCTTGTAATTTCAGCACTTTGG + Intronic
1096041663 12:48522374-48522396 TGCTTGTGATGCCAGCACTTTGG + Intronic
1096088020 12:48879307-48879329 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1096343646 12:50825729-50825751 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1096438451 12:51616657-51616679 TGCTTGTCATCTCCGCACTTTGG + Intronic
1096838379 12:54366099-54366121 TGCCTCTAATGCCAGCACTTTGG + Intergenic
1097123338 12:56753040-56753062 TGCTTGTAACGTCAGCACTTTGG + Intronic
1097251366 12:57634006-57634028 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1097464083 12:59901050-59901072 TTCTTCACATGGCAGCAGTAAGG - Intergenic
1097852919 12:64431202-64431224 TGCTTCTAATTCCAGCACTTTGG - Intronic
1097873625 12:64623079-64623101 TGCTTATAATCTCAGCACTCAGG - Intronic
1098096159 12:66958390-66958412 CGCTTCTAATGCCAGCACTTAGG - Intergenic
1098866632 12:75771188-75771210 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1098870431 12:75811564-75811586 TGCCTCTAATCCCAGCACTATGG + Intergenic
1098921571 12:76306827-76306849 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1099078153 12:78138439-78138461 TGTTTTTCAGGTCACCACTATGG + Intronic
1099303874 12:80931378-80931400 TGCTTGTCATTCCAGCACTTTGG + Intronic
1099407586 12:82282626-82282648 TTCTTCACATGGCAGCAGTAAGG - Intronic
1099411592 12:82335753-82335775 TGCTTGTCATTCCAGCACTTTGG - Intronic
1099449234 12:82788903-82788925 TGCCTGTCATCTCAGCACTTTGG + Intronic
1099745366 12:86695949-86695971 TGCTTGTAATCTCAGCACTTTGG + Intronic
1099849402 12:88073669-88073691 TGCTTATAATCTCAGCACTTTGG + Intronic
1099895903 12:88646220-88646242 TGCCTCTTATCTCAGCACTTTGG + Intergenic
1100322977 12:93514529-93514551 TGCCTGTAATGTCAGCACTTTGG - Exonic
1100325364 12:93535109-93535131 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1100432008 12:94539234-94539256 TGCTTGTAATCTCAGCACTTCGG + Intergenic
1100514769 12:95316730-95316752 TGCTTCTTATGGCAACACTGAGG - Intergenic
1100644087 12:96510708-96510730 CGCTTCTCATCACAGCACTTTGG + Intronic
1101689986 12:107068556-107068578 TGCTTATAATCTCAGCACTTTGG - Intronic
1101986186 12:109449158-109449180 TTTTTCTTATGTTAGCACTAAGG - Exonic
1102154306 12:110712377-110712399 TGCATGTCATCTCAGCACTTCGG + Intergenic
1102240014 12:111319476-111319498 TGCCTGTCATCTCAGCACTTTGG + Intronic
1102369801 12:112373003-112373025 TGCCTGTAATCTCAGCACTATGG - Intronic
1102494989 12:113313477-113313499 TGCTTATAATCTCAGCACTCTGG + Intronic
1102817390 12:115878654-115878676 TTGTTCTCATGACAGCACAATGG - Intergenic
1103019629 12:117523710-117523732 TGCTTGTCATCCCAGCACTTTGG + Intronic
1103079370 12:118011247-118011269 TGCTTTTAATCTCAGCACTTTGG + Intergenic
1103319536 12:120083508-120083530 TGCTTATAATCTCAGCACTTTGG - Intronic
1103354374 12:120308907-120308929 TGCCTGTCATCTCAGCACTTTGG + Intronic
1103453601 12:121047539-121047561 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1103478361 12:121234665-121234687 TGCTTGTAATCCCAGCACTATGG - Intergenic
1103599562 12:122045826-122045848 TGCTTATAATCTCAGCACTTTGG + Intronic
1103620656 12:122185212-122185234 TGCTTGTAATCTCAGCACTTTGG + Intronic
1103640395 12:122346761-122346783 TGCTTCTTATCCCAGCACTTTGG - Intronic
1103754262 12:123191059-123191081 TGCCTGTCATCTCAGCACTTTGG + Intronic
1103772039 12:123334926-123334948 TGCTTGTAATCTCAGCACTTTGG + Intronic
1103806661 12:123579070-123579092 TGCTTGTAATCTCAGCACTGTGG - Intergenic
1103826290 12:123741722-123741744 TGCTTGTCATCCCAGCACTTTGG - Intronic
1103849260 12:123921031-123921053 TGCTTCTAATCCCAGCACTTTGG - Intronic
1103982328 12:124744699-124744721 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1104235854 12:126936103-126936125 TGCCTATAATGTCAGCACTCTGG + Intergenic
1104414010 12:128582898-128582920 TGCTTATAATCTCAGCACTTTGG - Intronic
1107289161 13:38832782-38832804 TGCTTGTCATCTAAGCACTTTGG + Intronic
1108061834 13:46540904-46540926 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1108626458 13:52233493-52233515 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1108640131 13:52375765-52375787 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1108659609 13:52572995-52573017 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1108679779 13:52769680-52769702 TGCCTCTAATGCCAGCACTTTGG + Intergenic
1109127389 13:58534267-58534289 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1109307320 13:60655137-60655159 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1109993124 13:70085601-70085623 TGCTTGTAATCTCAGCACTTTGG + Intronic
1110054400 13:70947220-70947242 TGCCTATAATGTCAGCACTGTGG + Intergenic
1110478911 13:75950852-75950874 TGCTTGTAATATCAGCACTTTGG + Intergenic
1111064655 13:83073959-83073981 TTCTTCACATGGCAGCAGTAAGG - Intergenic
1111078433 13:83269213-83269235 AGCTTCTCATGCCACCATTATGG + Intergenic
1111229159 13:85318385-85318407 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1111977923 13:94986862-94986884 TGCTTATAATCTCAGCACTTTGG - Intergenic
1111980481 13:95010636-95010658 TGCTTCTAATCTTAGCACTTTGG + Intergenic
1112273052 13:97987761-97987783 TGCCTCTAATCTCAGCACTTTGG - Intronic
1112556047 13:100469516-100469538 TGCTTCTAATATCAGCACTTTGG + Intronic
1112954100 13:105038636-105038658 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1112988929 13:105486878-105486900 TGCCTGTAATCTCAGCACTATGG - Intronic
1113165633 13:107438541-107438563 TGCCTGTCATCTCAGCACTTTGG + Intronic
1113190714 13:107742523-107742545 TGCTTCTCATGGCGGCAGGAAGG - Intronic
1114008746 14:18343853-18343875 TGCTTGTGATGTAAGCACTTTGG - Intergenic
1114809041 14:25874117-25874139 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1115183407 14:30656219-30656241 TGCTTGTAATCTCAGCACTTTGG - Intronic
1115250137 14:31336352-31336374 TGCTTGTAATCTCAGCACTTTGG - Intronic
1115559104 14:34566960-34566982 TGCCTGTAATCTCAGCACTACGG + Intronic
1115590934 14:34864401-34864423 TGCCTCTAATCCCAGCACTATGG - Intronic
1115785194 14:36817623-36817645 TGCTGCTCAGCTCAGCACTTCGG + Intronic
1115826662 14:37285850-37285872 TGCCTCTAATCTCAGCACTGAGG - Intronic
1115842940 14:37492100-37492122 TGCTTGTAATATCAGCACTTTGG - Intronic
1115971381 14:38948633-38948655 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1116074352 14:40090936-40090958 TGTCTCTAATGTCAGCACTTTGG + Intergenic
1116171463 14:41407805-41407827 TGCTTCTCATATCAGAAGCAGGG - Intergenic
1116291770 14:43052109-43052131 TGCTTGTCATCTCAGCACTTTGG - Intergenic
1116431319 14:44848491-44848513 TGCCTATAATGTCAGCACTTTGG + Intergenic
1116453109 14:45086199-45086221 TGCCTGTCATCTCAGCACTTTGG - Intronic
1116651561 14:47600133-47600155 TGCTTCTAATCCCAGCACTTTGG + Intronic
1117631478 14:57697437-57697459 TGCTTGTAATCTCAGCACTTTGG + Intronic
1117882430 14:60325405-60325427 TGCTTATAATCTCAGCACTTTGG - Intergenic
1117971387 14:61254350-61254372 TGCTTGTAATCTCAGCACTTTGG + Intronic
1118203653 14:63701242-63701264 TGCCTCTCATCTCAGTACTGTGG - Intronic
1118341903 14:64901165-64901187 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1118383310 14:65235671-65235693 TGCCTGTCATCCCAGCACTATGG + Intergenic
1118668794 14:68100437-68100459 TGCTTGTAATCTCAGCACTTTGG - Intronic
1119002336 14:70893917-70893939 TGCCTGTCATCTCAGCACTATGG - Intergenic
1119282473 14:73421437-73421459 TGCTTGTAATTTCAGCACTTTGG - Intronic
1119358222 14:74024861-74024883 TGCCTGTAATGTCAGCACTTTGG - Intronic
1119416419 14:74473119-74473141 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1119425626 14:74533104-74533126 TGCTTGTAATCTCAGCACTTCGG - Intronic
1119455853 14:74755108-74755130 TGCTTATAATCTCAGCACTTTGG + Intergenic
1119695702 14:76712009-76712031 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1119816542 14:77573890-77573912 TGCCTGTCATCTCAGCACTTTGG - Intronic
1119956758 14:78807054-78807076 TCCTTCACAGATCAGCACTATGG + Intronic
1120026328 14:79588992-79589014 TGCTTGTAATCTCAGCACTTTGG + Intronic
1120029086 14:79619914-79619936 TGGTCCCCATGTCAGAACTAAGG - Intronic
1120424325 14:84328305-84328327 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1120630491 14:86884033-86884055 TGCTTGTAATCCCAGCACTATGG - Intergenic
1120928237 14:89819695-89819717 TGCCTGTCATTTCAGCACTTTGG - Intronic
1121025495 14:90613133-90613155 TGCCTGTCATCTCAGCACTTTGG + Intronic
1121897389 14:97661206-97661228 TGCCCCACATGTCAGAACTAAGG - Intergenic
1122032096 14:98919682-98919704 TGCTTCTCATGGCAACCCTGCGG + Intergenic
1122136637 14:99636725-99636747 TGCATGTAATGTCAGCACTTTGG + Intergenic
1122184224 14:99977833-99977855 TGCCTGTAATGTCAGCACTTTGG + Intronic
1122214802 14:100195960-100195982 TGCTTATAATCTCAGCACTTTGG + Intergenic
1122481782 14:102051950-102051972 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1123391948 15:19884428-19884450 TGCTTGTGATGTAAGCACTTTGG - Intergenic
1123462245 15:20483778-20483800 TGCTTGTCATCCCAGCACTTTGG + Intergenic
1123655814 15:22516593-22516615 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1124266863 15:28243926-28243948 TGCCTCTTATGTCAGCACTGTGG + Intronic
1124272932 15:28299789-28299811 TGCTTGTCATCCCAGCACTTTGG + Intronic
1124309724 15:28611776-28611798 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1124352795 15:28970414-28970436 TGCTTGTCATCTCAGCCCTTTGG + Intronic
1124909009 15:33899724-33899746 TGCCTGTCATCTCAGCACTTTGG - Intronic
1125315059 15:38422230-38422252 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1125652370 15:41327845-41327867 TGCTTGTAATGCCAGCACTTTGG + Intronic
1125683530 15:41548410-41548432 TGCTTATAATCTCAGCACTTTGG + Intergenic
1125963343 15:43851671-43851693 TGCTTGTAATCTCAGCACTTTGG + Intronic
1125982652 15:44017028-44017050 TGCTTTTAATCTCAGCACTTTGG - Intronic
1126025203 15:44439588-44439610 TGAGTGTCATGTCAGCACTCAGG + Intronic
1126077355 15:44924034-44924056 TGCTTGTAATCTCAGCACTTAGG - Intergenic
1126081366 15:44966836-44966858 TGCTTGTAATCTCAGCACTTAGG + Intronic
1126192374 15:45891378-45891400 TGCCTCTGATCTCAGCACTTTGG - Intergenic
1126649094 15:50903729-50903751 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1126882384 15:53113215-53113237 TGCTTGTAATTTCAGCACTTTGG + Intergenic
1127074640 15:55313611-55313633 CGCTTGTAATCTCAGCACTATGG + Intronic
1127427792 15:58873319-58873341 TGCCTCTAATCTCAGCACTTTGG - Intronic
1127603549 15:60562835-60562857 TGCCTGTAATGTCAGCACTTTGG - Intronic
1128018261 15:64367241-64367263 TGCCTCTAATCTCAGCACTTCGG + Intronic
1128261086 15:66233494-66233516 TGCCTGTCATCCCAGCACTAGGG - Intronic
1128286798 15:66443975-66443997 TGCTTGTCATCCCAGCACTTTGG + Intronic
1128303751 15:66584037-66584059 TGCCTGTGATGTCAGCACTTTGG - Intronic
1128531166 15:68449052-68449074 TGCCTCTCATCCCAGCACTTTGG - Intergenic
1128860277 15:71064572-71064594 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1129151705 15:73693019-73693041 AGCTTCTCATGACAGCCCTGGGG + Intronic
1129311082 15:74709714-74709736 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1129542491 15:76362231-76362253 TGCTTGTAATCTCAGCACTTTGG - Intronic
1130001691 15:80053446-80053468 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1130147980 15:81289393-81289415 TGCTTCTAATCCCAGCACTCTGG - Intronic
1130307312 15:82722049-82722071 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1130808092 15:87348143-87348165 TCCTTCTCTTGTCTCCACTAGGG - Intergenic
1130940414 15:88503735-88503757 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1131727081 15:95238390-95238412 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1131781509 15:95864693-95864715 TGCTTGTCATCCCAGCACTTTGG + Intergenic
1132176856 15:99722772-99722794 TGCCTCTAATGCCAGCACTTTGG + Intronic
1132272235 15:100536543-100536565 TGCCTGTCATCTCAGCACTTTGG - Intronic
1132492178 16:238277-238299 TGCTTCTAATTCCAGCACTTTGG - Intronic
1132537590 16:490582-490604 TGCTTCTAATTCCAGCACTTTGG - Intronic
1132636918 16:954395-954417 TGCTTCTCATGGCTGCCCTGTGG - Exonic
1132648272 16:1009046-1009068 TGCTTGTCATCCCAGCACTCTGG + Intergenic
1132938201 16:2492830-2492852 CGCTTCTAATCTCAGCACTTTGG + Intronic
1133016212 16:2942406-2942428 TGCTTGTAATGCCAGCACTTTGG - Intronic
1133114437 16:3568461-3568483 TGCTTGTCATTCCAGCACTTTGG + Intronic
1133161782 16:3916709-3916731 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1133215120 16:4287624-4287646 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1133300445 16:4779278-4779300 TCCTTGTCCTGTCAGCTCTATGG + Intronic
1133480016 16:6161126-6161148 TGCTTGTCATCCCAGCACTTGGG + Intronic
1133562824 16:6965595-6965617 TGCCTGTCATCTCAGCACTTTGG - Intronic
1133581114 16:7145465-7145487 CGCCTCTCATCTCAGCACTTTGG - Intronic
1133801891 16:9091558-9091580 TGCTTCTCCTGTCAGCATGTGGG + Intergenic
1134048054 16:11115969-11115991 TGCCTGTAATCTCAGCACTATGG - Intronic
1134364135 16:13561125-13561147 TGCTTTTAATCCCAGCACTATGG - Intergenic
1134445953 16:14331546-14331568 TGCCTGTAATGTCAGCACTTTGG + Intergenic
1134587176 16:15421833-15421855 TGCCTCTAATCTCAGCACTTTGG - Intronic
1134677865 16:16103087-16103109 TGCTTGTAATCTCAGCACTTTGG + Intronic
1134687073 16:16166307-16166329 TGCCTGTCATCTCAGCACTTTGG - Intronic
1134830297 16:17317370-17317392 TGCCTGTCATCTCAGCACTTTGG + Intronic
1135036469 16:19082368-19082390 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1135285053 16:21186213-21186235 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1135413932 16:22254804-22254826 TGCTTGTAATCTCAGCACTTTGG + Intronic
1135529810 16:23243403-23243425 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1135553050 16:23412944-23412966 TGCTTTTCATCCCAGCACTTTGG - Intronic
1135957132 16:26965246-26965268 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1136132035 16:28228908-28228930 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1136171214 16:28490806-28490828 TGCTTGTAATCTCAGCACTTTGG + Intronic
1136250434 16:29000936-29000958 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1136338060 16:29623814-29623836 TGCCTCTCATCCCAGCACTGTGG - Intergenic
1136410075 16:30071165-30071187 CGCCTATCATCTCAGCACTATGG - Intergenic
1137360978 16:47814860-47814882 TGCTTGTAATCCCAGCACTATGG - Intergenic
1137837859 16:51610797-51610819 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1138006281 16:53340907-53340929 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1138141885 16:54575882-54575904 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1138154980 16:54694622-54694644 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1138204761 16:55116346-55116368 AGCTTCTCATGCCACCACTGTGG - Intergenic
1138377198 16:56572740-56572762 TGCTTATAATCTCAGCACTTTGG + Intergenic
1138474383 16:57262159-57262181 TGCCTGTAATGTCAGCACTTTGG + Intronic
1138664331 16:58551672-58551694 TGCTGGTCAAGTTAGCACTATGG - Exonic
1138840905 16:60504759-60504781 TTCTTCTCCTGTCACCAGTAAGG + Intergenic
1139462441 16:67133392-67133414 TGCTTCTAATCCCAGCACTTTGG + Intronic
1139649272 16:68354115-68354137 TGCTTGTCATCCCAGCACTCTGG + Intronic
1139698003 16:68688878-68688900 TGCTTGTAATCTCAGCACTTTGG - Intronic
1139723724 16:68878810-68878832 TGCTTGTAATCTCAGCACTTTGG + Intronic
1140391243 16:74588979-74589001 TGCTTGTAATGCCAGCACTTTGG + Intronic
1140428308 16:74879923-74879945 TGCTTCTAATCCCAGCACTTTGG + Intronic
1140716299 16:77728495-77728517 CGCTTGTCATCTCAGCACTTTGG - Intronic
1140744588 16:77969950-77969972 TGCCTGTCATCTCAGCACTTAGG + Intronic
1140769006 16:78186501-78186523 TGCCTGTAATGTCAGCACTTTGG + Intronic
1141245104 16:82298608-82298630 GGGTTCTCATCTCAGCACTGTGG - Intergenic
1141829483 16:86501752-86501774 TGGTCCTCATGTCAGCTCTGTGG + Intergenic
1142320018 16:89375714-89375736 TGCTTGTAATCTCAGCACTTTGG - Intronic
1142577636 17:920158-920180 TGCTTGTCATCCCAGCACTTTGG - Intronic
1142628344 17:1206822-1206844 TGCTTGTCATCCCAGCACTTTGG + Intronic
1142652085 17:1360499-1360521 TGCTTGTAATCTCAGCACTTTGG + Intronic
1142681700 17:1553500-1553522 TGCTTATAATCTCAGCACTTTGG - Intronic
1142776253 17:2141701-2141723 TGCCTGTCATCTCAGCACTTTGG - Intronic
1142863170 17:2775916-2775938 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1142912686 17:3109350-3109372 TGCCTATAATGCCAGCACTATGG + Intergenic
1143179627 17:4976264-4976286 TGCTTCTAATCCCAGCACTTTGG - Intronic
1143664681 17:8350284-8350306 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1143713408 17:8749657-8749679 TGCCTGTCATTTCAGCACTTTGG - Intergenic
1143715299 17:8763481-8763503 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1144008872 17:11126392-11126414 TGCTTGTAATCTCAGCACTTCGG + Intergenic
1144325687 17:14177599-14177621 TGCTTTTTATGTCAGCTCTGGGG + Intronic
1144474561 17:15574487-15574509 TGCTTTTTATGTCAGCTCTGGGG + Intronic
1144922001 17:18771846-18771868 TGCTTGTAATTTCAGCACTTTGG + Intronic
1144932072 17:18867874-18867896 TGCATCTAATGCCAGCACTTTGG + Intronic
1145054600 17:19692870-19692892 TGCTTCTGATCCCAGCACTTTGG + Intronic
1145362525 17:22223890-22223912 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1146226440 17:31070651-31070673 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1146267371 17:31461680-31461702 TGCTTGTCATCCCAGCACTTTGG - Intronic
1146339899 17:32009531-32009553 TGCCTGTCATCTCAGCACTTTGG - Intronic
1146702991 17:34978445-34978467 TGCCTGTCATCTCAGCACTTTGG + Intronic
1146762302 17:35489120-35489142 TGATTCTCACGCCAGCTCTAAGG + Intronic
1146921330 17:36714538-36714560 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1146987885 17:37239087-37239109 TGCTTGTCATCTTAGCACTTTGG - Intronic
1147015261 17:37487233-37487255 TGCCTCTAATCCCAGCACTATGG + Intergenic
1147295450 17:39478452-39478474 TGCTTCCAATCCCAGCACTATGG - Intronic
1147775265 17:42896383-42896405 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1148572529 17:48681664-48681686 TGCTTATAATGCCAGCACTTTGG + Intergenic
1148814396 17:50316871-50316893 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1149301386 17:55307427-55307449 TGCTTGTAATGCCAGCACTTTGG - Intronic
1149322991 17:55500383-55500405 TGCCTGTAATCTCAGCACTATGG - Intergenic
1149888170 17:60361517-60361539 TGCTTCTCCAGTGAGCACTAGGG + Intronic
1150050702 17:61959272-61959294 TGCCTCTAATCTCAGCACTTTGG - Intronic
1150058179 17:62038933-62038955 TGCTTGTAATCTCAGCACTTTGG - Intronic
1150312604 17:64141215-64141237 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1150420540 17:65030750-65030772 TGCTTGTAATCTCAGCACTTTGG + Intronic
1150606795 17:66698710-66698732 TGCTTCTAATCCCAGCACTTTGG + Intronic
1150719596 17:67602999-67603021 TGCTTGTAATCCCAGCACTACGG - Intronic
1150786370 17:68166234-68166256 GGCTCCTCTTGTCAGCTCTAAGG + Intergenic
1151063574 17:71124840-71124862 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1151528736 17:74690218-74690240 TGCCTCTAATCTCAGCACTTTGG - Intronic
1151530503 17:74701595-74701617 TGCTTTTAATCTCAGCACTTTGG + Intronic
1151636807 17:75354901-75354923 TGCTTGTAATCTCAGCACTTCGG + Intronic
1151644467 17:75420608-75420630 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1151847304 17:76665825-76665847 TGCTTGTAATCCCAGCACTATGG - Intergenic
1152116261 17:78389443-78389465 TGCTTGTAATCTCAGCACTTTGG - Intronic
1152126392 17:78449934-78449956 TGCCTGTCATCTCAGCACTATGG - Intronic
1153111130 18:1589078-1589100 TGCCTGTAATCTCAGCACTATGG + Intergenic
1153190212 18:2529790-2529812 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1153314832 18:3711576-3711598 TGCTTCTAATGCCGGCACTTTGG + Intronic
1153362768 18:4216156-4216178 TCCTTCTCATGGCAGCAACAAGG + Intronic
1153581432 18:6577857-6577879 TGCTTATAATCTCAGCACTTTGG - Intronic
1153848444 18:9070599-9070621 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1153995996 18:10441897-10441919 TGCTTGTAATTTCAGCACTTTGG + Intergenic
1154211514 18:12382967-12382989 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1154270862 18:12918095-12918117 TGCTTGTAATCTCAGCACTTTGG - Intronic
1154398990 18:14017231-14017253 TGCCTGTAATGTCAGCACTTTGG + Intergenic
1154407636 18:14108828-14108850 TGCTTGTAATCTCAGCACTTTGG + Intronic
1154934384 18:21036700-21036722 TGCTTGTCATCTCAGCACTTTGG - Intronic
1154997378 18:21653637-21653659 TGCTTGTAATCTCAGCACTTTGG + Intronic
1155210318 18:23594944-23594966 TGCTTCTAATCCCAGCACTTTGG - Intergenic
1156130383 18:33965687-33965709 TTCTTCACATGGCAGCAGTAAGG - Intronic
1156638273 18:39057577-39057599 TGCTTGTAATCCCAGCACTATGG - Intergenic
1156840022 18:41600288-41600310 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1157282456 18:46355211-46355233 TGCTTGTAATCTCAGCACTTTGG - Intronic
1157659996 18:49432858-49432880 TGCTTGTAATGTCAGCACTGTGG - Intronic
1158044416 18:53138086-53138108 TGCTTGTAATCTCAGCACTTTGG - Intronic
1158355879 18:56618947-56618969 TGCTTCTAATCCCAGCACTTTGG + Intronic
1158398394 18:57097862-57097884 TGCTTGTAATGCCAGCACTTTGG + Intergenic
1158473315 18:57758117-57758139 TGCTTATAATCTCAGCACTTCGG - Intronic
1158508108 18:58064844-58064866 TCCCTCTCATCTCAGCACTTTGG + Intronic
1158603311 18:58873280-58873302 TGCCTCTGATCTCAGCACTTTGG - Intronic
1159035248 18:63271080-63271102 TGCTTGTAATCTCAGCACTTCGG - Intronic
1159593256 18:70357865-70357887 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1160113916 18:76059129-76059151 TGCTTCTCATGGGGGCTCTAGGG - Intergenic
1160168908 18:76536741-76536763 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1160721400 19:598564-598586 TGCTTCTAATGCCAGCACCTTGG - Intronic
1160789258 19:915766-915788 TGCTTGTCATCCCAGCACTTTGG + Intergenic
1160882255 19:1326255-1326277 CGCTTGTCATCTCAGCACTTTGG + Intergenic
1161040095 19:2105833-2105855 TGCTTCTAATACCAGCACTTTGG + Intronic
1161406163 19:4092336-4092358 TGCTTATAATCTCAGCACTCTGG + Intronic
1161552241 19:4920169-4920191 TGCTTGTAATTTCAGCACTTCGG + Intronic
1161750192 19:6090226-6090248 TGCTTGTAATCTCAGCACTTTGG - Intronic
1161803970 19:6431701-6431723 TGCCTCTAATGCCAGCACTTTGG - Intronic
1161824822 19:6555665-6555687 TGCCTGTCATGTCAGCACTTTGG + Intergenic
1161862843 19:6811294-6811316 TGCTTATAATCCCAGCACTATGG - Intronic
1161920352 19:7261146-7261168 TGCTTGTAATGCCAGCACTTTGG - Intronic
1161936249 19:7374018-7374040 TGCCTGTCATGTCAGCACTTGGG - Intronic
1162251564 19:9448493-9448515 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1162288038 19:9755122-9755144 TGCTTCTAATTCCAGCACTTTGG - Intronic
1162338612 19:10077689-10077711 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1162347948 19:10131810-10131832 TGCTTGTAATGCCAGCACTTTGG + Intergenic
1162443286 19:10706631-10706653 CGCTTGTCATCTCAGCACTTTGG - Intronic
1162810402 19:13161176-13161198 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1162882300 19:13668817-13668839 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1163092244 19:15028516-15028538 CGCTTCTAATCTCAGCACTCTGG - Intergenic
1163284814 19:16339738-16339760 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1163457609 19:17417343-17417365 TGCTTGTAATGCCAGCACTTTGG + Intronic
1163524256 19:17810946-17810968 TGCTTGTAATGTCAGCATTTTGG + Intronic
1163639544 19:18453827-18453849 TGCCTATAATGTCAGCACTTTGG - Intronic
1163686036 19:18712204-18712226 TGCTTCTAATTCCAGCACTTTGG - Intronic
1163746742 19:19053225-19053247 TGCCTGTAATGTCAGCACTTTGG + Intronic
1163970462 19:20788790-20788812 TGCTTGTAATCTCAGCACTTTGG + Intronic
1164058098 19:21640022-21640044 TGCTTGTTATTTCAGCACTTTGG - Intergenic
1164169490 19:22712298-22712320 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1164587731 19:29487147-29487169 TGCTTGTGATCTCAGCACTTTGG + Intergenic
1164681578 19:30137436-30137458 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1164947366 19:32307784-32307806 TGCTTGTCCTGGCAGCACTGTGG - Intergenic
1165125330 19:33591764-33591786 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1165133149 19:33645864-33645886 TGCCTCTAATCTCAGCACTTTGG + Intronic
1165407602 19:35640336-35640358 TGCTTCTAATTACAGCACTAAGG + Intergenic
1165484541 19:36087554-36087576 TGCTTGTCATCCCAGCACTTTGG + Intronic
1165669918 19:37667329-37667351 TGCCTCTCATCTTAGCACTTTGG - Intronic
1165716719 19:38050796-38050818 TGCTTGTAATCTCAGCACTTTGG + Intronic
1165780429 19:38430495-38430517 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1165836869 19:38763171-38763193 TGCTTGTAATGCCAGCACTTTGG + Intronic
1165870410 19:38968358-38968380 TGCCTGTAATGTCAGCACTTTGG + Intronic
1165962052 19:39543217-39543239 TGCCTGTAATCTCAGCACTATGG + Intergenic
1166074502 19:40405895-40405917 TGCCTGTCATCTCAGCACTCTGG - Intronic
1166076482 19:40416627-40416649 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1166085009 19:40468638-40468660 TGCTTATAATCTCAGCACTTTGG - Intronic
1166113317 19:40636725-40636747 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1166266814 19:41689519-41689541 TGCTTGTAATCTCAGCACTTTGG - Intronic
1166331993 19:42083682-42083704 TGCCTCTCATCCCAGCACTTTGG - Intergenic
1166572660 19:43807841-43807863 TGCTTCTGATGTCAGCCCCTTGG - Intronic
1167081427 19:47278632-47278654 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1167098523 19:47389589-47389611 TACTTCCCAAGTCAGCAATATGG + Intergenic
1167732107 19:51265873-51265895 TCCCTCTCATGTGAGTACTAGGG + Exonic
1167848529 19:52184217-52184239 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1167858113 19:52259018-52259040 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1167867257 19:52338421-52338443 TGCTTCTAATCCCAGCACTTTGG + Intronic
1168108140 19:54176790-54176812 TGCTTGTAATCTCAGCACTTTGG + Intronic
1168173331 19:54605868-54605890 TGCTTGTAATCTCAGCACTTTGG + Intronic
1168514341 19:56998502-56998524 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1168599203 19:57704757-57704779 TCCTTCTCATGACAAGACTATGG - Intronic
1168661386 19:58170214-58170236 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1168668449 19:58222340-58222362 TGCTTGTAATCTCAGCACTTTGG - Intergenic
925187989 2:1862680-1862702 TGCTTCTCATGTCTTCCCTCTGG + Intronic
926207284 2:10842791-10842813 TACTTCTCTTGTCAACACTAGGG + Intergenic
926668293 2:15549466-15549488 TGCCTGTAATGTCAGCACTTTGG + Intronic
926716998 2:15932609-15932631 TGCCTGTCATCTCAGCACTTTGG + Intergenic
926734741 2:16064432-16064454 TTCTTCACATGTCAGCAGGAAGG + Intergenic
927771384 2:25865168-25865190 CGCTTGTAATGTCAGCACTTTGG + Intronic
927933360 2:27059886-27059908 TGCTTATAATCCCAGCACTATGG + Intronic
928004397 2:27550677-27550699 TGCTTATAATCTCAGCACTTTGG - Intronic
928697767 2:33867284-33867306 TGCTTGTAATCTCAGCACTTTGG - Intergenic
929196572 2:39191136-39191158 TGCCTCTCATCCCAGCACTTTGG + Intronic
929508173 2:42545115-42545137 TGCTTGTAATCTCAGCACTTTGG + Intronic
929741185 2:44602241-44602263 TGCTTCTAATACCAGCACTTTGG - Intronic
930092395 2:47540663-47540685 TGCCTGTCATGCCAGCACTTTGG + Intronic
930450753 2:51534396-51534418 TGCTTGTAATCTCAGCACTTTGG + Intergenic
930605157 2:53486130-53486152 TGCTTCACCTCTCAGTACTAGGG - Intergenic
930681598 2:54262957-54262979 TGCCTGTGATGCCAGCACTATGG + Intronic
930794012 2:55368582-55368604 TGCCTGTAATCTCAGCACTATGG - Intronic
931238922 2:60435318-60435340 TGCCTCTCTTCCCAGCACTAAGG + Intergenic
931240698 2:60449882-60449904 TGCCTCTAATCCCAGCACTATGG + Intergenic
931285351 2:60827545-60827567 TGCTTGTAATCTCAGCACTTTGG - Intergenic
931373326 2:61684572-61684594 TGCATGTCATGTCAGCACTTTGG - Intergenic
932192219 2:69750672-69750694 TGCTTGTCATCCCAGCACTTTGG - Intronic
932196461 2:69788277-69788299 TGCCTGTCATCTCAGCACTTTGG + Intronic
932604838 2:73158013-73158035 TGCTATTCAGGTTAGCACTAGGG + Intergenic
932810961 2:74825901-74825923 TGCTTATAATGTCAGCATTTTGG - Intergenic
933003571 2:76958969-76958991 TGCTTCCCTTTTCAGCACCAAGG - Intronic
933399234 2:81770813-81770835 TGCTTGTAATCTCAGCACTTTGG - Intergenic
933489666 2:82969819-82969841 TGCTTGTAATTTCAGCACTTTGG - Intergenic
933680632 2:85096706-85096728 TGCTTATAATCTCAGCACTTTGG - Intergenic
933682976 2:85119388-85119410 TGCTTATAATGCCAGCACTTTGG + Intergenic
933730665 2:85453951-85453973 TGCTTGTAATCTCAGCACTTTGG + Intergenic
933804703 2:85989614-85989636 TGCCTGTCATCTCAGCACTTTGG - Intergenic
933957556 2:87383858-87383880 TGCCTGTCATCTCAGCACTTTGG - Intergenic
934120769 2:88837053-88837075 TGCCTCTGATGTCTGAACTAGGG - Intergenic
934241674 2:90275753-90275775 TGCCTGTCATCTCAGCACTTTGG - Intergenic
934271499 2:91540932-91540954 TGCCTGTCATCTCAGCACTTTGG + Intergenic
934732624 2:96669141-96669163 AGCTTCTCACATCAGCTCTAGGG + Intergenic
934789596 2:97047353-97047375 TGCCTCTAATCTCAGCACTTTGG - Intergenic
934816872 2:97335187-97335209 TGCCTCTAATCTCAGCACTTTGG + Intergenic
934820824 2:97373297-97373319 TGCCTCTAATCTCAGCACTTTGG - Intergenic
935169234 2:100597698-100597720 TGCTTGTAATCTCAGCACTTTGG - Intergenic
936509773 2:113135958-113135980 TGCTTGTAATCTCAGCACTTTGG + Intergenic
937405623 2:121625692-121625714 TGCTTGTAATGCCAGCACTTTGG - Intronic
937581409 2:123493314-123493336 TGCCTCTAATCTCAGCACTTTGG - Intergenic
938538968 2:132270009-132270031 TGCTTGTCATCCCAGCACTTTGG + Intergenic
938706656 2:133936595-133936617 TGCTTATGATCTCAGCACTTTGG + Intergenic
939330509 2:140753500-140753522 GGCTTCTCATGTCAACATTCTGG - Intronic
939403209 2:141722115-141722137 TGCCTCTAATCTCAGCACTTTGG + Intronic
939605537 2:144250401-144250423 TGCTTGTAATCTCAGCACTTTGG - Intronic
939612534 2:144328209-144328231 TGCTTGTAATCTCAGCACTTTGG - Intronic
939633949 2:144558880-144558902 TGCTTCTAATCCCAGCACTTTGG + Intergenic
939763304 2:146211941-146211963 TTATTCTCATGACAGTACTATGG + Intergenic
939908068 2:147943288-147943310 TGCTTGTAATGTCAGCACTTAGG + Intronic
940132319 2:150396338-150396360 TGCTTGTAATCTCAGCACTTTGG + Intergenic
940945029 2:159606450-159606472 TGCTTCCTATGTCATCACAATGG + Intronic
940963541 2:159812671-159812693 TGCTTGTAATCTCAGCACTTTGG - Intronic
941305960 2:163867765-163867787 TTCTTCACATGGCAGCAGTAAGG + Intergenic
941356191 2:164495200-164495222 TGCCTGTAATCTCAGCACTATGG - Intronic
941700749 2:168601808-168601830 TGCCTGTAATCTCAGCACTATGG - Intronic
941772341 2:169358730-169358752 TGCCTATAATGTCAGCACTTTGG + Intronic
942316525 2:174701541-174701563 TGCTTGTAATCTCAGCACTTTGG + Intergenic
942342245 2:174960864-174960886 TGCCTGTAATGTCAGCACTTTGG + Intronic
942665588 2:178313154-178313176 TGCTTGTAATCTCAGCACTTTGG - Intronic
942666388 2:178323721-178323743 TGCTTGTAATCTCAGCACTTTGG - Intronic
942721344 2:178956560-178956582 TGCTTATAATACCAGCACTATGG - Intronic
942758839 2:179374081-179374103 TGCTTGTAATCCCAGCACTATGG - Intergenic
942826942 2:180189974-180189996 TGCTTGTAATCTCAGCACTTTGG + Intergenic
943643633 2:190385186-190385208 TGCTTGTAATCTCAGCACTTTGG + Intergenic
944244861 2:197520795-197520817 TGCTTGTAATGCCAGCACTTTGG + Intronic
944693652 2:202181313-202181335 TGCCTGTCATGTCAACACTTTGG + Intronic
944775683 2:202962229-202962251 TGCCTCTAATCTCAGCACTTTGG + Intronic
944853091 2:203740390-203740412 TGCCTGTAATGTCAGCACTTTGG + Intergenic
945011779 2:205471621-205471643 TGCTTCTAATCCCAGCACTTTGG - Intronic
945015236 2:205508310-205508332 TGCTTGTAATTTCAGCACTTTGG + Intronic
945151109 2:206792962-206792984 TGCTTGTCATCCCAGCACTTGGG + Intergenic
945628979 2:212247701-212247723 TGCTTGTAATCTCAGCACTCTGG + Intronic
945975593 2:216268081-216268103 TGCTTCTCATGTCAGTTTTGTGG + Intronic
946379277 2:219333656-219333678 TGCTTGTAATCTCAGCACTTTGG + Intergenic
946621263 2:221565845-221565867 TGCTTCTCTTCTCAGAACAATGG + Intronic
946857928 2:223971563-223971585 TGCTTGTAATCTCAGCACTTTGG + Intergenic
947122121 2:226827223-226827245 TGCCTGTCATCTCAGCACTTTGG - Intergenic
947659257 2:231854537-231854559 TGCCTCTCATCCCAGCACTTTGG - Intergenic
947745549 2:232505677-232505699 TGCCTCTAATCTCAGCACTTTGG - Intergenic
948160151 2:235816628-235816650 CGCCTGTCATGTCAGCACTTTGG + Intronic
948162865 2:235839484-235839506 TGCCTCTAATCTCAGCACTTCGG + Intronic
948377129 2:237528609-237528631 CGCTTGTAATGTCAGCACTTTGG - Intronic
949013630 2:241696821-241696843 TGCCTCTCATCCCAGCACTTTGG + Intergenic
949020235 2:241736919-241736941 TGCCTGTCATCTCAGCACTTTGG - Intronic
1168779767 20:478666-478688 TGCCTCTAATCTCAGCACTTTGG + Intronic
1169522308 20:6386909-6386931 TTCTTCACATGGCAGCAGTAAGG - Intergenic
1169865644 20:10197080-10197102 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1170034040 20:11971480-11971502 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1170790281 20:19502768-19502790 TGCTTGTAATCTCAGCACTTTGG + Intronic
1170935853 20:20808749-20808771 TGCTTGTGATCTCAGCACTTTGG + Intergenic
1171811606 20:29748799-29748821 TGCCTCTCATCCCAGCACTTTGG + Intergenic
1172051123 20:32119196-32119218 TGCTTGTAATGTCAGCACTTTGG + Intronic
1172171509 20:32937238-32937260 TGCTTCTAATACCAGCACTTTGG - Intronic
1172249606 20:33469677-33469699 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1172260088 20:33556693-33556715 TGCTTATAATGTCAGCACTCTGG - Intronic
1172268998 20:33642339-33642361 TGCTTGTAATCTCAGCACTTTGG + Intronic
1172418542 20:34793041-34793063 TGCTTGTAATCTCAGCACTTTGG - Intronic
1172508388 20:35481155-35481177 TGCCTGTCATCTCAGCACTTTGG + Intronic
1172594051 20:36137479-36137501 TGCCTATAATCTCAGCACTATGG - Intronic
1172599311 20:36172858-36172880 TGCTTGTAATCTCAGCACTTTGG - Intronic
1172712510 20:36936878-36936900 TGCTTGTAATGCCAGCACTTTGG + Intronic
1173224390 20:41153634-41153656 TGCTTCTAATCCCAGCACTTTGG + Intronic
1173526089 20:43733810-43733832 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1173531799 20:43775374-43775396 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1173911974 20:46677172-46677194 TGCTTGTAATGCCAGCACTTTGG - Intronic
1174014717 20:47478541-47478563 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1174095036 20:48081975-48081997 TGCTTGTAATTTCAGCACTTTGG + Intergenic
1174131476 20:48346503-48346525 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1174440911 20:50552566-50552588 TGCCTGTAATCTCAGCACTATGG + Intronic
1174473289 20:50777287-50777309 TGCTTGTGATCTCAGCACTTTGG - Intergenic
1175033299 20:55975864-55975886 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1175064160 20:56271371-56271393 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1175282748 20:57815032-57815054 TGATTCTCTTGTCACCACTTTGG - Intergenic
1175791345 20:61741796-61741818 TGCCTGTCATCTCAGCACTTTGG - Intronic
1175842074 20:62034588-62034610 TGCCTGTCATCTCAGCACTTTGG - Intronic
1175867614 20:62189060-62189082 TGCTTGTAATCTCAGCACTTTGG + Intronic
1177741680 21:25161813-25161835 TTCTTCTCATGGCAGCAGGAAGG - Intergenic
1178208399 21:30497626-30497648 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1179142991 21:38743781-38743803 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1179228127 21:39474224-39474246 TGCCTCTAATCTCAGCACTTCGG - Intronic
1179313009 21:40213520-40213542 TGTTGCTCATGTCTGCATTATGG - Intronic
1179910607 21:44445740-44445762 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1180433249 22:15274670-15274692 TGCTTGTGATGTAAGCACTTTGG - Intergenic
1180693559 22:17737911-17737933 TGCCTCTGATGCCAGCACAAGGG - Intronic
1181011885 22:20045761-20045783 TGCTTCTAATCCCAGCACTTTGG - Intronic
1181012233 22:20048183-20048205 TGCCTGTAATGTCAGCACTTCGG - Intronic
1181102024 22:20547557-20547579 CGCTTGTAATGTCAGCACTTTGG + Intronic
1181882208 22:25990034-25990056 TCCTTCTCATGCCACCACCACGG + Intronic
1182086081 22:27562174-27562196 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1182178434 22:28318168-28318190 TGCCTCTCATCTCAGCACTGTGG - Intronic
1182183677 22:28378398-28378420 TGCCTGTAATCTCAGCACTATGG + Intronic
1182314925 22:29439371-29439393 TGCCTGTAATGTCAGCACTTTGG + Intronic
1182414939 22:30215372-30215394 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1182672413 22:32007781-32007803 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1183146644 22:35998635-35998657 TGCTTGTAATCTCAGCACTTTGG - Intronic
1183804610 22:40197545-40197567 TGCTTGTAATCTCAGCACTTTGG - Intronic
1183892495 22:40941438-40941460 TGCATGTCATCTCAGCACTTTGG + Intergenic
1183908353 22:41060025-41060047 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1183920278 22:41161355-41161377 TGCCTGTCATCTCAGCACTTTGG + Intronic
1183972359 22:41487142-41487164 TGCCTGTCATCTCAGCACTCTGG - Intronic
1184802288 22:46768831-46768853 TGCCTGTCATCTCAGCACTTTGG + Intronic
1185396583 22:50594395-50594417 TGCTTGTAATCTCAGCACTCTGG + Intronic
1185397017 22:50597748-50597770 TGCCTGTCATCTCAGCACTCTGG + Intronic
949227785 3:1714548-1714570 TGCGTGTAATCTCAGCACTATGG + Intergenic
949325091 3:2854531-2854553 TGCTTGTAATGCCAGCACTTTGG - Intronic
949484150 3:4521587-4521609 TGCTTGTAATCTCAGCACTTTGG + Intronic
949496052 3:4633194-4633216 TGCCTGTAATGTCAGCACTTTGG - Intronic
949531936 3:4964786-4964808 TGCCTATAATCTCAGCACTATGG - Intergenic
950322505 3:12070058-12070080 TGCCTATCATCTCAGCACTTTGG - Intronic
950361004 3:12449283-12449305 TGCTTGTCATCCCAGCACTTTGG + Intergenic
950595964 3:13981779-13981801 TGCTTGTAATCTCAGCACTTTGG - Intronic
951010117 3:17667710-17667732 TGCTTGTAATCCCAGCACTATGG - Intronic
951088937 3:18549424-18549446 TCCTTCTAAAGACAGCACTAAGG - Intergenic
951339008 3:21461288-21461310 TGCTTGTAATCTCAGCACTTTGG + Intronic
951546885 3:23835207-23835229 TGCTTGTAATCTCAGCACTTTGG + Intronic
951560534 3:23961654-23961676 TGCTTCTAATCACAGCACTTTGG - Intronic
952295479 3:32058585-32058607 TGCCTGTAATGTCAGCACTTTGG - Intronic
952754045 3:36850506-36850528 TGCTTATAATCTCAGCACTTCGG + Intronic
952999734 3:38921497-38921519 TGCTCCTCATAGCAGCACTGAGG - Intronic
953552670 3:43916163-43916185 TGCTTGTAATGTCAGCACTTTGG - Intergenic
953751737 3:45614265-45614287 TGCTTGTCATCCCAGCACTTTGG + Intronic
953942553 3:47113226-47113248 TGCTTGTAATCTCAGCGCTATGG - Intronic
954195369 3:48993599-48993621 TGCTTCTAATCCCAGCACTTTGG + Intronic
954234064 3:49242201-49242223 TGCTTGTAATGCCAGCACTTTGG - Intronic
954545039 3:51426468-51426490 TGCTTGTAATTTCAGCACTTTGG - Intronic
954584897 3:51724820-51724842 TGCTTGTAATCTCAGCACTTTGG + Intergenic
954694410 3:52413572-52413594 TGCCTGTAATGTCAGCACTTTGG + Intronic
954787105 3:53101774-53101796 TGCTTGTAATCTCAGCACTTTGG + Intronic
954817889 3:53297955-53297977 TGCTTATAATCTCAGCACTTTGG + Intronic
955047084 3:55370571-55370593 TGGTCCTCATTCCAGCACTAAGG + Intergenic
955359542 3:58261368-58261390 TGCTTGTAATTTCAGCACTTTGG + Intronic
955389437 3:58509864-58509886 TGCTTGTAATCTCAGCACTTTGG - Intronic
955419067 3:58718980-58719002 TGCTTGTAATGCCAGCACTTTGG + Intronic
955688536 3:61567720-61567742 TGCCTGTCATCTCAGCACTTTGG + Intronic
955745686 3:62138456-62138478 TGCCTATAATGTCAGCACTTTGG + Intronic
955756303 3:62228260-62228282 TGCCTGTCATCTCAGCACTTTGG + Intronic
955960175 3:64332557-64332579 TTATTTTCAAGTCAGCACTAAGG + Intronic
955964747 3:64377976-64377998 TGCTTGTAATCTCAGCACTTTGG + Intronic
956130292 3:66046875-66046897 TGCTTGTAATCTCAGCACTTTGG - Intergenic
956234725 3:67056700-67056722 TGCTTGTAATCTCAGCACTTTGG + Intergenic
956440826 3:69278847-69278869 TGCTTCTAATCCCAGCACTTTGG - Intronic
956442748 3:69296073-69296095 TGCTTGTAATCTCAGCACTTTGG - Intronic
956873386 3:73439996-73440018 TGCCTGTAATGTCAGCACTTTGG - Intronic
957035130 3:75287253-75287275 TGCTTGTAATGTCAGCAATTTGG - Intergenic
957221822 3:77391818-77391840 TGCTTATAATGCCAGCACTTTGG - Intronic
957486437 3:80868629-80868651 GTCTTCTCCTGTCATCACTATGG + Intergenic
957752648 3:84441844-84441866 TGCCTCTAATTTCAGCACTTTGG - Intergenic
958757613 3:98269979-98270001 TGCTTGTCATCCCAGCACTTTGG - Intergenic
959071106 3:101702921-101702943 CGCTTGTAATGTCAGCACTTTGG + Intergenic
959468198 3:106716018-106716040 TGCCTGTAATCTCAGCACTATGG - Intergenic
959579163 3:107966644-107966666 TGTTTCTCCTGGCAACACTAAGG - Intergenic
960270293 3:115666603-115666625 TGATTCTCATATCAGCCCAATGG + Intronic
960337711 3:116438675-116438697 TGCTTCTAATGCTATCACTAAGG - Intronic
960573990 3:119211477-119211499 TGCTTATCATGCAAGCCCTAGGG - Intergenic
960637066 3:119794583-119794605 TGCCTCTAATGTCAGCACTTTGG - Intronic
960683661 3:120275008-120275030 TGCTTCTCATCTCTGAAGTATGG - Intronic
960704563 3:120469444-120469466 TGCTTCTAATCCCAGCACTTTGG - Intergenic
961079016 3:124008858-124008880 TGCTTGTAATGTCAGCACTTTGG - Intergenic
961304462 3:125947614-125947636 TGCTTGTAATGTCAGCACTTTGG + Intergenic
961473491 3:127133088-127133110 AGCTTCTTTTGTCAGCACGATGG + Intergenic
961801772 3:129456376-129456398 TGCTTGTGATCTCAGCACTTTGG + Intronic
962324418 3:134421710-134421732 TGCTACACATGGTAGCACTATGG - Intergenic
962528768 3:136259204-136259226 CGCTTGTCATCTCAGCACTTTGG + Exonic
962645915 3:137439988-137440010 TGGTGCCAATGTCAGCACTAGGG - Intergenic
962694408 3:137933268-137933290 TGCTTGTAATCTCAGCACTTTGG - Intergenic
962698885 3:137978053-137978075 TGCTTGTAATCTCAGCACTTTGG - Intergenic
962803521 3:138910430-138910452 CGCTTGTCATCTCAGCACTTTGG + Intergenic
962918721 3:139932861-139932883 TTGTTCTCATGTCAGCAGCAGGG + Intergenic
963792958 3:149602918-149602940 TGCCTATCATCTCAGCACTTTGG - Intronic
964476407 3:157101576-157101598 TGCTTGGCATGTCAGAACTTGGG + Intergenic
964939046 3:162132329-162132351 TGCTTATGATATCAGCACTAAGG + Intergenic
965127962 3:164654212-164654234 TGCTTGTAATCTCAGCACTTTGG + Intergenic
965544083 3:169897825-169897847 TGCCTCTAATCTCAGCACTTTGG - Intergenic
965748726 3:171954206-171954228 TGCCTGTAATGTCAGCACTTTGG - Intergenic
965801864 3:172502620-172502642 TGCTTGTCATCCCAGCACTTTGG - Intergenic
966296999 3:178435651-178435673 TGCTTCTCATGTCAGCACTATGG + Intronic
966902320 3:184495578-184495600 TGCTTGTAATTCCAGCACTATGG - Intronic
966937341 3:184719624-184719646 TGCTTCTAATCCCAGCACTTTGG - Intergenic
967015123 3:185474834-185474856 TGCTTGTAATGCCAGCACTTTGG + Intronic
967331403 3:188293802-188293824 TGCTTGTAATCTCAGCACTTTGG + Intronic
967733729 3:192931032-192931054 TGCCTCTAATCTCAGCACTTTGG + Intergenic
967737974 3:192973522-192973544 TGCTTGTAATCTCAGCACTTTGG + Intergenic
967783907 3:193469363-193469385 TGCCTGTAATGTCAGCACTTTGG + Intronic
968023463 3:195417190-195417212 TGCCTGTAATGTCAGCACTTTGG - Intronic
968208207 3:196823603-196823625 TGCTTGTAATCTCAGCACTTTGG + Intronic
968678259 4:1897529-1897551 TGCTTGTAATGCCAGCACTTTGG + Intronic
968793218 4:2683551-2683573 TGCCTGTAATCTCAGCACTATGG - Intronic
968842207 4:3015811-3015833 TGCCTGTCATTTCAGCACTTTGG + Intronic
968947485 4:3673030-3673052 TTCTTCACATGACAGCAGTAAGG - Intergenic
969012808 4:4080830-4080852 TGCTTGTCATCCCAGCACTTTGG + Intergenic
969744793 4:9061703-9061725 TGCCTGTCATCTCAGCACTTTGG + Intergenic
969840242 4:9876330-9876352 TGCTTGTAATCTCAGCACTTTGG + Intronic
970066191 4:12096262-12096284 TGCTTATCATGTAAGTACAAGGG - Intergenic
971450531 4:26796571-26796593 TGCCTGTAATGTCAGCACTTTGG + Intergenic
972291787 4:37696435-37696457 TGCCTCTAATCTCAGCACTTTGG - Intergenic
972473088 4:39425855-39425877 TGCCTGTAATGTCAGCACTTTGG + Intronic
972600392 4:40566906-40566928 TGCTTGTAATCTCAGCACTTTGG - Intronic
973191494 4:47390915-47390937 TGCCTCTAATGACAGCACTTTGG + Intronic
973248784 4:48040283-48040305 TGCCTGTAATGTCAGCACTTTGG + Intergenic
973293937 4:48495153-48495175 AGCTTCTCATGACAACACTGAGG + Intergenic
973807338 4:54538982-54539004 TGCCTGTAATCTCAGCACTATGG - Intergenic
973939763 4:55894880-55894902 TGCTTGTAATCTCAGCACTTTGG - Intronic
974013880 4:56631630-56631652 TGCTTGTAATCTCAGCACTTTGG + Intergenic
974348178 4:60709306-60709328 TGCTTGTAATGCCAGCACTTTGG - Intergenic
974396761 4:61346501-61346523 TGCCTGTAATGTCAGCACTTTGG + Intronic
974397277 4:61353699-61353721 TGCCTGTAATGTCAGCACTTTGG - Intronic
974472921 4:62341200-62341222 TGCTTGTCATCTCAGCACTTTGG + Intergenic
974788619 4:66656035-66656057 TGCTTGTAATCTCAGCACTTTGG + Intergenic
975037042 4:69696922-69696944 TGCCTGTCATCTCAGCACTCTGG - Intergenic
975053270 4:69893477-69893499 TGCTTGTAATCTCAGCACTTTGG + Intergenic
975055710 4:69926645-69926667 TGCCTGTCATCTCAGCACTTTGG - Intergenic
975175904 4:71288657-71288679 TGCCTGTAATCTCAGCACTATGG - Intronic
976139311 4:81973742-81973764 TGCTTCTCATGTCAGTTCTAGGG + Intronic
976224685 4:82786537-82786559 TGCTTGTAATGCCAGCACTTTGG + Intronic
976404991 4:84653134-84653156 TGCTTGTAATCTCAGCACTTTGG - Intergenic
976663035 4:87560191-87560213 TGCCTCTAATCTCAGCACTTAGG - Intergenic
977216295 4:94287890-94287912 TGCTTATAATGCCAGCACTTGGG + Intronic
977322036 4:95529464-95529486 TGCTTGTAATCTCAGCACTTTGG + Intronic
977861099 4:101960971-101960993 TGCTTCTCAAGTCAGAAAGATGG - Intronic
978242574 4:106534303-106534325 TGCTTGTAATCTCAGCACTGTGG - Intergenic
978700243 4:111634596-111634618 TTCTTCTCATGTCAGCTCCCAGG - Intergenic
979011537 4:115376708-115376730 TGCCTGTAATGTCAGCACTTTGG - Intergenic
979424240 4:120545960-120545982 TGCTTGTAATCTCAGCACTTTGG + Intergenic
979930415 4:126623336-126623358 TGCTTGTAATCTCAGCACTTTGG + Intergenic
980446376 4:132913831-132913853 TGCTTGTAATCTCAGCACTTTGG - Intergenic
980925128 4:139128780-139128802 TGCTTGTAATGCCAGCACTTTGG - Intronic
981425822 4:144601899-144601921 TGCTTGTAATGCCAGCACTTCGG + Intergenic
981883997 4:149650648-149650670 TGCCTGTAATGTCAGCACTTTGG - Intergenic
982027039 4:151261255-151261277 TGCTTCTCTTCTCAGGTCTAAGG + Intronic
982217661 4:153096027-153096049 TGCCTGTCATCTCAGCACTTTGG + Intergenic
982554419 4:156841366-156841388 TTCTTCACATGTCAGCAGGAAGG - Intronic
982608443 4:157542422-157542444 TGCTTGTAATCTCAGCACTTTGG - Intergenic
982919020 4:161250591-161250613 TGCCTATAATCTCAGCACTATGG + Intergenic
983227188 4:165096145-165096167 TGCCTGTAATGCCAGCACTATGG + Intronic
983443333 4:167815919-167815941 TGCTTCTAATTCCAGCACTTTGG + Intergenic
983760609 4:171401566-171401588 TGCTTGTCATCCCAGCACTTTGG + Intergenic
983946475 4:173591495-173591517 TGCTTGTAATCTCAGCACTTTGG + Intergenic
984720984 4:182972946-182972968 TGCTTATAATCTCAGCACTTTGG + Intergenic
984764193 4:183387030-183387052 TGCCTCTAATCTCAGCACTTTGG - Intergenic
984831036 4:183973733-183973755 TGCCTCTGATCTCAGCACTTTGG + Intronic
984861871 4:184247505-184247527 TGCTTGTAATCTCAGCACTTTGG - Intergenic
985369580 4:189271342-189271364 TGCTTGTAATCTCAGCACTTTGG - Intergenic
985427277 4:189843204-189843226 TGCTTGTAATCTCAGCACTTTGG - Intergenic
985662254 5:1163181-1163203 TTCTTCCCATGGCAGCACTGGGG + Intergenic
985701658 5:1377134-1377156 TGCTTCTCATGACTGCATTTAGG + Intergenic
985713617 5:1443956-1443978 TGCCTGTCATCTCAGCACTTTGG - Intronic
985998899 5:3614677-3614699 TGCCTGTCATCTCAGCACTTTGG - Intergenic
986144518 5:5064908-5064930 TGCCTGTAATCTCAGCACTATGG + Intergenic
987783666 5:22470676-22470698 TGCTTGTAATGCCAGCACTTTGG - Intronic
987814389 5:22881778-22881800 TTCTTCTCATGGCAGCAGCAAGG + Intergenic
988185510 5:27855706-27855728 TGCTTCTTATGTCTGGACAATGG - Intergenic
988232305 5:28495709-28495731 TGTTTCTCATGTCTGCTCCAGGG - Intergenic
988291185 5:29288873-29288895 TGCTCCTCATATCATCATTAGGG - Intergenic
988937162 5:36095929-36095951 TGCTTGTAATCTCAGCACTTTGG - Intergenic
988992941 5:36689368-36689390 TGCTTCTTATGTCTGCATTGTGG - Intergenic
989071949 5:37520528-37520550 TGTTTCTTATTTCAGCATTAGGG + Intronic
989285391 5:39693053-39693075 TGCTTATCGTGCCAGCACTGGGG + Intergenic
989382954 5:40827037-40827059 TGCTTGTCATCCCAGCACTTTGG - Exonic
989390462 5:40895314-40895336 TGCTTATAATGCCAGCACTTTGG - Intergenic
989451530 5:41592135-41592157 TGCTGCTCATGTCAGGTCTGTGG - Intergenic
989462253 5:41714090-41714112 TGCTTCTAATCCCAGCACTTTGG - Intergenic
989598472 5:43180053-43180075 TGCCTGTCATCTCAGCACTTTGG - Intronic
989813221 5:45703024-45703046 TGCTTGTAATCTCAGCACTTTGG - Intergenic
989962465 5:50432816-50432838 CGCTTCTAATCTCAGCACTTTGG + Intronic
990161678 5:52947436-52947458 TGCTGCTCATTTTAGCACTGTGG + Exonic
990479226 5:56192165-56192187 TGCTCCTCATGTAAGCAGTGTGG - Intronic
990488280 5:56280086-56280108 TGCTTCTCATCACAGAACAAAGG + Intergenic
990698482 5:58449516-58449538 TGCTTGTAATCTCAGCACTTTGG - Intergenic
990861944 5:60337057-60337079 TGCTTGTAATCTCAGCACTTTGG + Intronic
990924419 5:61003925-61003947 TGCTTGTAATCTCAGCACTTTGG - Intronic
992060017 5:73035155-73035177 TGCTTGTAATCTCAGCACTTTGG + Intronic
992218118 5:74545624-74545646 TGCCTGTAATGCCAGCACTATGG + Intergenic
992395355 5:76364519-76364541 TGCCTCTAATTTCAGCACTTTGG + Intergenic
992447439 5:76846694-76846716 TGCCTCTAATGCCAGCACTTTGG - Intergenic
992464797 5:76993269-76993291 TGCTTATAATCTCAGCACTTTGG + Intergenic
992639750 5:78759011-78759033 TGCCTCTAATCTCAGCACTTTGG + Intronic
992789136 5:80198096-80198118 TGCCTGTAATGTCAGCACTTTGG - Intronic
992819603 5:80483127-80483149 TGCCTCTAATCTCAGCACTTTGG - Intergenic
993242392 5:85407463-85407485 ATCTTCTAATGTCAGCAGTATGG + Intergenic
993460559 5:88176447-88176469 TGCTTGTAATCTCAGCACTTTGG + Intergenic
993719080 5:91304281-91304303 TGCTTGTAATATCAGCACTTTGG - Intergenic
993822784 5:92640938-92640960 TTTTTCTGATGTCAGCACCATGG - Intergenic
993999771 5:94765437-94765459 TGCCTGTCATCTCAGCACTTTGG + Intronic
995428336 5:112048735-112048757 TGCCTGTCATCTCAGCACTTTGG + Intergenic
996212175 5:120824943-120824965 TGCTTGTAATTTCAGCACTTTGG + Intergenic
996557393 5:124793008-124793030 TGCCTCTCATCCCAGCACTTTGG + Intergenic
996885284 5:128346676-128346698 TGCTTATAATTTCAGCACTTTGG + Intronic
997130161 5:131268710-131268732 TGCTTCCAATCTCAGCACTTTGG - Intronic
997318561 5:132958743-132958765 TCCTTTTCATGTCATCATTAGGG - Intronic
997800674 5:136857918-136857940 GGCTGCTCATGTGAACACTAGGG + Intergenic
998017497 5:138744145-138744167 TGCTTATAATCCCAGCACTATGG - Intronic
998028991 5:138847423-138847445 TGCCTCTAATCTCAGCACTCTGG - Intronic
998122351 5:139589049-139589071 TGCCTGTAATGTCAGCACTTTGG - Intronic
998268150 5:140682116-140682138 TGCCTGTAATGTCAGCACTTTGG + Intronic
998416326 5:141948951-141948973 TGCCTCTAATGCCAGCACTTTGG + Intronic
999214425 5:149920065-149920087 TGCTTGTAATCTCAGCACTTTGG + Intronic
999291939 5:150431412-150431434 TGCTTGTAATGCCAGCACTATGG + Intergenic
999366291 5:151025862-151025884 TGCTTCTCTTGGCAGCTCTCTGG + Intronic
1000251413 5:159499153-159499175 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1000787919 5:165569747-165569769 TGCTTCATATGACAGCAGTAAGG + Intergenic
1001604044 5:172947430-172947452 TGCCTGTCATCTCAGCACTTCGG - Intronic
1002200108 5:177523258-177523280 TGCTTCTCATCCTAGCACTTTGG - Intronic
1002362010 5:178679760-178679782 TGCTTGTCATCCCAGCACTTTGG + Intergenic
1002378245 5:178804407-178804429 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1002435919 5:179230748-179230770 TGCTTCTAATCCCAGCACTTTGG + Intronic
1002486195 5:179538856-179538878 TGCTTGTAATTCCAGCACTATGG + Intergenic
1002620083 5:180481969-180481991 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1002702607 5:181136138-181136160 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1003002343 6:2347875-2347897 TGCTTGTAATCTCAGCACTTAGG + Intergenic
1003262279 6:4529582-4529604 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1003598942 6:7500634-7500656 TGCCTCTCATCCCAGCACTTTGG + Intergenic
1003668822 6:8136425-8136447 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1003922497 6:10846387-10846409 TGCTTCTAATCCCAGTACTATGG - Intronic
1004441109 6:15655383-15655405 TGCTTCTAATCCCAGCACTTGGG - Intronic
1004515106 6:16315940-16315962 TGCTTGTAATCTCAGCACTTTGG - Intronic
1004532908 6:16470730-16470752 TGCTTGTAATTTCAGCACTTTGG + Intronic
1004541531 6:16554849-16554871 TGCTTGTAATCTCAGCACTTTGG - Intronic
1004623142 6:17348937-17348959 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1004650607 6:17603844-17603866 TGCTTGTAATCTCAGCACTTTGG - Intronic
1004895006 6:20139813-20139835 TGCTTGTAATCTCAGCACTTTGG - Intronic
1005043196 6:21617819-21617841 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1006178323 6:32137476-32137498 TGCTTATAATCTCAGCACTTTGG - Intergenic
1006279716 6:33040836-33040858 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1006481057 6:34294464-34294486 TGCTTGTAATTCCAGCACTATGG + Intronic
1006490080 6:34379752-34379774 TGCTTGTAATCTCAGCACTTTGG + Intronic
1006697880 6:35946948-35946970 TGCCTGTAATGTCAGCACTTTGG - Intronic
1006723547 6:36177841-36177863 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1006882527 6:37352810-37352832 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1007033472 6:38650836-38650858 TGCCTATCATCTCAGCACTTTGG - Intergenic
1007060493 6:38936086-38936108 TGCTTCTAATCCCAGCACTTTGG + Intronic
1007447072 6:41915171-41915193 TGCCTGTCATCTCAGCACTTTGG + Intronic
1007457912 6:41994811-41994833 TGCTTGTAATCTCAGCACTTTGG + Intronic
1007894617 6:45340582-45340604 TGCTTATAATCTCAGCACTTTGG - Intronic
1009424211 6:63496711-63496733 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1009641986 6:66349914-66349936 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1009715938 6:67395500-67395522 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1010422986 6:75695134-75695156 TGCCTGTAATGTCAGCACTTTGG - Intronic
1010515041 6:76762295-76762317 TTCTTCTCATGGCAGCAGGAAGG + Intergenic
1010563271 6:77377120-77377142 TGCATCTCTTGTCAGAACTGAGG - Intergenic
1011409472 6:87052749-87052771 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1011605637 6:89102389-89102411 TGCCTGTCATCTCAGCACTTTGG - Intronic
1011836773 6:91441140-91441162 CGCTTGTAATCTCAGCACTATGG - Intergenic
1011940545 6:92837036-92837058 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1013002139 6:106033574-106033596 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1013298363 6:108780456-108780478 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1013330880 6:109098751-109098773 TGCCTCTAATCTCAGCACTTTGG - Intronic
1013337434 6:109178411-109178433 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1013373424 6:109490521-109490543 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1014099132 6:117489946-117489968 TGCTTCTGTTGTAAGCATTAGGG - Intronic
1014448715 6:121558816-121558838 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1015096946 6:129427236-129427258 TCTTTCTCATTTCAGCACTTGGG + Intronic
1015490136 6:133815512-133815534 TGCTCCTCATGCCAGGACCATGG + Intergenic
1015890250 6:137963311-137963333 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1015894204 6:138000486-138000508 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1016557828 6:145359217-145359239 TGCTTGTCATCTCAGCACTTTGG - Intergenic
1016570476 6:145507025-145507047 TGCTTATAATCTCAGCACTTTGG - Intronic
1016711511 6:147177989-147178011 TGCTTGTAATTTCAGCACTTTGG - Intergenic
1016942476 6:149494448-149494470 TGCTTGTAATCTCAGCACTCTGG - Intergenic
1017129728 6:151097912-151097934 TGCTTCTAATCTCAGCAGTTTGG + Intronic
1017139812 6:151180299-151180321 TGCCTGTCATCTCAGCACTCTGG - Intergenic
1017472354 6:154751486-154751508 TGCTTGTAATCTCAGCACTTTGG - Intronic
1017910659 6:158789878-158789900 TGCCTATAATCTCAGCACTATGG - Intronic
1018076814 6:160223988-160224010 TGCTTCTAATCCCAGCACTTTGG - Intronic
1019084843 6:169466414-169466436 TTCTTCACATGTCAGCAAAAAGG + Intronic
1019490968 7:1313227-1313249 TGCCTATCATCTCAGCACTTTGG - Intergenic
1019708206 7:2506474-2506496 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1019736799 7:2654132-2654154 TGCCTGTCATCTCAGCACTCTGG + Intronic
1019833587 7:3358280-3358302 TGCTTCTAATCCCAGCACTTTGG - Intronic
1020159389 7:5756894-5756916 TGCTTGTAATGCCAGCACTTTGG - Intronic
1020165782 7:5806761-5806783 CGCCTCTCATCTCAGCACTTTGG - Intergenic
1020172189 7:5853740-5853762 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1020174392 7:5870728-5870750 TGCTTGACATGTCAGCACAGAGG + Intergenic
1020208091 7:6135048-6135070 TGCCTATCATCTCAGCACTCTGG - Intronic
1020408138 7:7860498-7860520 TGCTTGTAATCTCAGCACTTTGG + Intronic
1020958919 7:14777571-14777593 TTCTTCACATGGCAGCAGTAAGG - Intronic
1021535658 7:21701548-21701570 TGCCTGTCATCTCAGCACTTTGG - Intronic
1021837129 7:24689072-24689094 TGCTTGTAATCTCAGCACTTTGG - Exonic
1021871198 7:25007852-25007874 TGTGTCTCATGTCACCACTGGGG + Intergenic
1021904145 7:25316754-25316776 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1021983191 7:26074524-26074546 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1022246915 7:28569288-28569310 TGCCTGTAATGTCAGCACTTTGG - Intronic
1022398806 7:30016165-30016187 TGCTTCTAATCCCAGCACTTTGG - Intronic
1022651679 7:32282838-32282860 TGCCTGTAATGTCAGCACTTTGG - Intronic
1023118187 7:36883177-36883199 AGCCTGTCATGTCAGCACTTAGG + Intronic
1023821129 7:43981076-43981098 TGCTTGTAATTTCAGCACTTTGG + Intergenic
1025049415 7:55721906-55721928 TGCTTCTAATCCCAGCACTTTGG - Intergenic
1025068295 7:55876004-55876026 TGCCTGTAATTTCAGCACTATGG - Intergenic
1025271300 7:57520649-57520671 TGCTTGTCATCTCAGCACTTTGG + Intergenic
1025616082 7:63118219-63118241 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1026116117 7:67497185-67497207 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1026404373 7:70050094-70050116 TGCCTCTAATCTCAGCACTTTGG + Intronic
1026453294 7:70548380-70548402 TGCTTCAAAAGTCAGCATTACGG - Intronic
1026612504 7:71872872-71872894 TGCTTGTAATCTCAGCACTTTGG - Intronic
1026761937 7:73133473-73133495 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1026788148 7:73314586-73314608 TGCCTGTCATCTCAGCACTTTGG + Intronic
1026798339 7:73380178-73380200 TGCTTGTTATCTCAGCACTTTGG - Intergenic
1026798506 7:73381541-73381563 TGCCTGTAATGTCAGCACTTTGG + Intergenic
1026949857 7:74339825-74339847 TGCTTGTAATCTCAGCACTTTGG + Intronic
1027038278 7:74942297-74942319 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1027085285 7:75259185-75259207 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1027195066 7:76024356-76024378 TGCCTGTCATCCCAGCACTATGG + Intronic
1027234357 7:76289190-76289212 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1027372924 7:77525974-77525996 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1027870167 7:83696486-83696508 TGAATCTCATGTCATCACTTTGG + Intergenic
1028008904 7:85615012-85615034 TGCTTGTCTTGTCAGCACACAGG + Intergenic
1028157035 7:87441857-87441879 TGCTTGTGATCTCAGCACTTTGG - Intronic
1028179353 7:87699664-87699686 TGCTTGTAATCTCAGCACTTTGG - Intronic
1028216555 7:88140298-88140320 TGCTTCTCAGCTGAGCACTTAGG + Intronic
1028273527 7:88822948-88822970 TGCCTGTAATGTCAGCACTTTGG + Intronic
1028405013 7:90465319-90465341 TGCTTCGCATGGCAGCAGGAAGG - Intronic
1028541161 7:91943815-91943837 TGTTTCTGATGCCAGCAATATGG - Intronic
1028716485 7:93977198-93977220 TGCTTGTAATCTCAGCACTTTGG + Intronic
1028791645 7:94860210-94860232 TGCCTCTAATGCCAGCACTTTGG - Intergenic
1028794871 7:94891596-94891618 TGCCTATTATCTCAGCACTATGG + Intergenic
1029068522 7:97876115-97876137 TGCCTATCATCTCAGCACTTTGG - Intergenic
1029100327 7:98124523-98124545 TGCCTGTCATCTCAGCACTTTGG + Intronic
1029124930 7:98289216-98289238 TGCTTGTCATCCCAGCACTTTGG - Intronic
1029186599 7:98743299-98743321 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1029360648 7:100086220-100086242 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1029689616 7:102172508-102172530 TGCTTGTAATCTCAGCACTTTGG - Intronic
1029749402 7:102534515-102534537 TGCTTGTAATTTCAGCACTTTGG + Intergenic
1029767348 7:102633620-102633642 TGCTTGTAATTTCAGCACTTTGG + Intronic
1030062754 7:105636132-105636154 TGCCTGTAATGTCAGCACTTTGG + Intronic
1030590673 7:111477636-111477658 TGCCTGTAATCTCAGCACTATGG + Intronic
1030908441 7:115215176-115215198 TGCTTGTAATGCCAGCACTTTGG + Intergenic
1030956422 7:115857633-115857655 TGCTTCTAATCCCAGCACTTTGG - Intergenic
1031084368 7:117287725-117287747 TGCTTGTAATATCAGCACTTTGG + Intronic
1031096329 7:117425727-117425749 TGCTTGTAATCTCAGCACTTTGG + Intronic
1031410720 7:121437576-121437598 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1031444982 7:121842042-121842064 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1031543798 7:123027840-123027862 TGCCTGTAATGTCAGCACTGTGG - Intergenic
1031583285 7:123504187-123504209 TGCTTGTAATATCAGCACTTTGG + Intronic
1031793469 7:126139935-126139957 TCCTTCACATGGCAGCAGTAAGG + Intergenic
1032160697 7:129507408-129507430 TGCCTGTCATCTCAGCACTTTGG - Intronic
1032277239 7:130469037-130469059 TGCCTGTAATGTCAGCACTTTGG + Intergenic
1032569134 7:132981269-132981291 TGCTTGTAATCTCAGCACTTTGG - Intronic
1032728198 7:134611737-134611759 TGCTTGTAATTCCAGCACTATGG - Intergenic
1032734117 7:134674171-134674193 TGCCTCTAATCTCAGCACTTTGG - Intronic
1032741191 7:134741262-134741284 TTCTTCACATGGCAGCAGTAAGG + Intergenic
1032754723 7:134878306-134878328 TGCGTGTAATGTCAGCACTTTGG + Intronic
1032862828 7:135897618-135897640 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1033123579 7:138687495-138687517 TGCCTCTAATCTCAGCACTTTGG - Intronic
1033542195 7:142367439-142367461 TGCCTATCATTTCAGCACTTTGG - Intergenic
1034114210 7:148568626-148568648 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1034153201 7:148933268-148933290 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1034539772 7:151749834-151749856 TGCCTGTCATCTCAGCACTTTGG + Intronic
1034636825 7:152574274-152574296 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1034856387 7:154552251-154552273 TGCCCCTCATGCCATCACTAAGG + Intronic
1034884642 7:154789935-154789957 TGCTTGTCATCCCAGCACTTTGG + Intronic
1035001987 7:155619863-155619885 TGCTTATGATCTCAGCACTTTGG + Intronic
1035740059 8:1920586-1920608 TGCCTATAATGTCAGCACTTTGG - Intronic
1036727889 8:11236360-11236382 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1036806192 8:11835871-11835893 TGCCTCTAATCTCAGCACTTTGG + Intronic
1036895612 8:12632586-12632608 TGCCTCTCATCCCAGCACTCTGG + Intergenic
1037161548 8:15779326-15779348 TGCTTGTAATATCAGCACTATGG - Intergenic
1037533858 8:19806950-19806972 TGCCTATAATGTCAGCACTTTGG - Intergenic
1037563558 8:20096605-20096627 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1038287202 8:26215970-26215992 CGCCTCTCATCTCAGCACTTTGG + Intergenic
1038953862 8:32446392-32446414 TGCTTGTAATCTCAGCACTTTGG + Intronic
1039586285 8:38709907-38709929 TGCTTGTAATCTCAGCACTTAGG - Intergenic
1040028316 8:42802046-42802068 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1040360182 8:46657911-46657933 TGCCTGTAATTTCAGCACTATGG + Intergenic
1040395780 8:46998914-46998936 TGCCTGTAATCTCAGCACTATGG - Intergenic
1040513762 8:48117914-48117936 TGCTTCTAATCCCAGCACTTTGG - Intergenic
1040799327 8:51323651-51323673 TGCTTATAATCTCAGCACTTTGG + Intronic
1041134353 8:54740781-54740803 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1041514199 8:58682102-58682124 TGCTTCTTATCCCAGCACTTTGG + Intergenic
1041851589 8:62399243-62399265 TGCTTGTAATCTCAGCACTTCGG + Intronic
1042161132 8:65896996-65897018 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1042305944 8:67333291-67333313 TGCTTGTAATCTCAGCACTTTGG - Intronic
1042978732 8:74501598-74501620 TGCCCATCATGCCAGCACTAGGG - Intergenic
1043050880 8:75384073-75384095 TCATTCTCCTGTCATCACTAAGG - Intergenic
1043327175 8:79066863-79066885 TGCTTTTCATATAAGCTCTAGGG - Intergenic
1043444662 8:80307466-80307488 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1043550642 8:81368375-81368397 TGCTTGTAATGCCAGCACTTTGG - Intergenic
1043789342 8:84444066-84444088 TGCCTGTCATGTCAGCACTTTGG + Intronic
1043793204 8:84500015-84500037 TGCTTATAATGCCAGCACTTTGG - Intronic
1044683698 8:94806920-94806942 TGCTTCTAATCGCAGCACTTTGG + Intergenic
1044999072 8:97864651-97864673 TGCCTGTCATGTCAGCCCTTTGG - Intergenic
1045211181 8:100101551-100101573 TGCTTGTAATCTCAGCACTTTGG - Intronic
1045295871 8:100871398-100871420 TGCCTCTAATGCCAGCACTTTGG + Intergenic
1045392569 8:101730219-101730241 TGCCTCTAATCTCAGCACTTTGG + Intronic
1045452064 8:102337006-102337028 TGCTTATAATCTCAGCACTTTGG - Intronic
1045463594 8:102448372-102448394 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1045531407 8:102988649-102988671 TGCTTGTAATCTCAGCACTGTGG + Intergenic
1046428159 8:114083768-114083790 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1046474894 8:114729347-114729369 TGCTAATAATGTCTGCACTATGG - Intergenic
1047404223 8:124571703-124571725 TGCTTCTAATCCCAGCACTTTGG + Intronic
1047942157 8:129836623-129836645 TGCTTATAATCCCAGCACTATGG + Intergenic
1047948074 8:129902478-129902500 TGCCTGTCATCTCAGCACTTTGG - Intronic
1048890626 8:138943313-138943335 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1048950848 8:139495696-139495718 TGCTTCTCCAGTCTGAACTAAGG - Intergenic
1049049679 8:140184706-140184728 TGCTTGTAATGCCAGCACTTTGG - Intronic
1049112357 8:140654977-140654999 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1049149069 8:141022710-141022732 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1049838064 8:144753014-144753036 TGCTTGTAATCTCAGCACTTTGG + Intronic
1049940664 9:543293-543315 TGCTTGTAATCTCAGCACTTTGG + Intronic
1051290238 9:15538197-15538219 TGCTTGAAATGTCAGCACTTTGG + Intergenic
1051403935 9:16713812-16713834 TGCTTCTAATCCCAGCACTTTGG + Intronic
1051462591 9:17338431-17338453 TGCCTCTAATCTCAGCACTTTGG - Intronic
1051727201 9:20100319-20100341 TGCTTGTAATGCCAGCACTCTGG - Intergenic
1052195001 9:25701390-25701412 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1052873462 9:33531972-33531994 TGCTTGTAATCTCAGCACTTTGG + Intronic
1052926895 9:34024721-34024743 TGCCTGTCATCTCAGCACTTTGG + Intronic
1053126834 9:35588439-35588461 TGCTTCTAATCCCAGCACTTTGG + Intergenic
1053258985 9:36645006-36645028 TGCCTGTAATGTCAGCACTTTGG + Intronic
1053563510 9:39221920-39221942 TGCTTGTAATCTCAGCACTTTGG - Intronic
1053657959 9:40239267-40239289 TGCCTGTCATCTCAGCACTTTGG - Intronic
1053829294 9:42059848-42059870 TGCTTGTAATCTCAGCACTTTGG - Intronic
1054133637 9:61397146-61397168 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1054370080 9:64385543-64385565 TGCCTGTCATCTCAGCACTTTGG - Intronic
1054526637 9:66136954-66136976 TGCCTGTCATCTCAGCACTTTGG + Intronic
1054601265 9:67127599-67127621 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1054677711 9:67875297-67875319 TGCCTGTCATCTCAGCACTTTGG - Intronic
1054729336 9:68684983-68685005 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1055057137 9:72034346-72034368 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1055518577 9:77058125-77058147 CGCTTGTCATCTCAGCACTTTGG - Intergenic
1055592947 9:77837289-77837311 TGCCTCTAATCTCAGCACTTTGG + Intronic
1055739787 9:79374951-79374973 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1055751938 9:79516144-79516166 TGCTTCTAATCCCAGCACTTTGG + Intergenic
1055753662 9:79534274-79534296 TGCTTGTAATCTCAGCACTGTGG + Intergenic
1055804117 9:80074072-80074094 TGCTTATAATCTCAGCACTATGG - Intergenic
1056182264 9:84096885-84096907 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1056677888 9:88691745-88691767 TGCTTTGCATGTGAGCACCAGGG - Intergenic
1057039632 9:91838578-91838600 TGCTTCTGATGTTACCACTGGGG + Intronic
1057519495 9:95750278-95750300 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1057544181 9:96005051-96005073 TGCTTGTAATCTCAGCACTTTGG + Intronic
1057756187 9:97838486-97838508 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1057962255 9:99468224-99468246 TGCTTATAATCTCAGCACTTTGG + Intergenic
1058916952 9:109576648-109576670 TGCCTCTAATTTCAGCACTTTGG - Intergenic
1058993644 9:110278589-110278611 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1059215750 9:112560448-112560470 TGCCTGTCATCTCAGCACTTTGG - Intronic
1059347640 9:113640637-113640659 TGGTTCTAAGGTCAGCACTAGGG - Intergenic
1059710696 9:116865208-116865230 TGCTTGTAATCTCAGCACTTTGG + Intronic
1059724943 9:116998473-116998495 GGCTTCTTGTGTCAGCACCATGG - Intronic
1059864806 9:118502345-118502367 TGCTTGTAATCTCAGCACTTTGG - Intergenic
1059865645 9:118511264-118511286 TGCTTCTAATCCCAGCACTTTGG + Intergenic
1060240668 9:121899662-121899684 TGCTTGTAATCTCAGCACTTTGG - Intronic
1060586226 9:124787817-124787839 TGCTTCTAATCCCAGCACTTTGG - Intronic
1060654116 9:125356933-125356955 TGCCTGTCATCTCAGCACTTTGG - Intronic
1060974557 9:127756890-127756912 TGCTTGTAATGCCAGCACTTTGG - Intronic
1061049728 9:128187345-128187367 TGCTTCCCATCCCAGCACTGGGG - Intronic
1061081996 9:128376724-128376746 TGCTTCTGATTTCAGCACTTTGG + Intronic
1061120277 9:128637701-128637723 TGCCTGTCATCTCAGCACTTTGG - Intronic
1061382602 9:130267203-130267225 TGCTTGTAATTTCAGCACTTTGG - Intergenic
1061438492 9:130582188-130582210 TGCTTGTAATCTCAGCACTTTGG + Intronic
1062356330 9:136165389-136165411 TGCCTATCATCTCAGCACTTCGG - Intergenic
1185445466 X:255606-255628 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1185516841 X:706370-706392 TGCTTATAATCTCAGCACTTTGG - Intergenic
1185563696 X:1080107-1080129 TGCTTGTCATCCCAGCACTTTGG - Intergenic
1185786741 X:2897453-2897475 TGCTTATCATCCCAGCACTTTGG - Intergenic
1186033601 X:5396214-5396236 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1186170875 X:6875309-6875331 TGCCTCTAATGCCAGCACTTTGG - Intergenic
1186180654 X:6969614-6969636 TGCTTATAATCTCAGCACTTTGG + Intergenic
1186221002 X:7349262-7349284 TGCTTGTAATATCAGCACTTTGG - Intronic
1186331737 X:8541831-8541853 CCGTTCTCATGTCAGCACTTTGG - Intronic
1186486565 X:9938147-9938169 TCATTCTCATGTTGGCACTAGGG - Intronic
1186506057 X:10093229-10093251 TGCTTATAATCTCAGCACTTTGG + Intronic
1186918296 X:14247620-14247642 AGCCTCTGCTGTCAGCACTAGGG - Intergenic
1187706602 X:22015423-22015445 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1187928979 X:24276637-24276659 TGCCTGTCATCTCAGCACTTTGG + Intergenic
1188349845 X:29114886-29114908 TGCTTCTAATCCCAGCACTTTGG - Intronic
1188480152 X:30629348-30629370 TGCCTGTAATGTCAGCACTTTGG + Intergenic
1188502017 X:30837311-30837333 TGCTTATAATCTCAGCACTTTGG - Intronic
1188938865 X:36212850-36212872 TGCTTGTAATCTCAGCACTTCGG + Intergenic
1190325264 X:49203324-49203346 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1190357458 X:49618990-49619012 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1190717942 X:53119977-53119999 TGCCTGTCATCTCAGCACTTTGG - Intergenic
1190880229 X:54486726-54486748 TGCTTGTAATCTCAGCACTTTGG + Intronic
1190993789 X:55583737-55583759 TGCTTGTAATCCCAGCACTATGG + Intergenic
1192223206 X:69211339-69211361 TAATTCTCATGACAGCACTATGG - Intergenic
1192468995 X:71380312-71380334 TGCTTGTAATCTCAGCACTTTGG - Intronic
1192600972 X:72463539-72463561 TACTTTTCTTGACAGCACTAAGG - Intronic
1192778377 X:74268755-74268777 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1193379089 X:80797833-80797855 TGCCTGTCATCTCAGCACTTTGG + Intronic
1193488586 X:82118898-82118920 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1193584167 X:83300312-83300334 TGCCTGTAATCTCAGCACTATGG + Intergenic
1193658157 X:84223904-84223926 TGCCTCTAATCTCAGCACTTTGG + Intergenic
1193667742 X:84343546-84343568 TGCCTCTAATCTCAGCACTTTGG - Intronic
1193824477 X:86205825-86205847 TGCTTGTCATCTCAGCACTTTGG - Intronic
1195409299 X:104551842-104551864 TACTTCTCTTGTCAGGATTATGG - Intergenic
1197937895 X:131758904-131758926 TGCCTGTAATGTCAGCACTTTGG - Intergenic
1197947280 X:131852957-131852979 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1198435299 X:136611052-136611074 TGCCTCTAATCTCAGCACTTTGG - Intergenic
1198573740 X:137987280-137987302 CGCTTGTAATGTCAGCACTTTGG + Intergenic
1198585523 X:138116410-138116432 TGCTTGTAATTCCAGCACTATGG - Intergenic
1200712159 Y:6495730-6495752 TGCCTGTCATCTCAGCACTTGGG - Intergenic
1200766477 Y:7084560-7084582 TGCTTCTAATCCCAGCACTTTGG - Intronic
1200773128 Y:7145646-7145668 TGCCTGTAATTTCAGCACTATGG - Intergenic
1200952303 Y:8910811-8910833 TGCCTGTCATCTCAGCACTTGGG + Intergenic
1201021771 Y:9666239-9666261 TGCCTGTCATCTCAGCACTTGGG + Intergenic
1201287648 Y:12392751-12392773 TGCTTATCATCCCAGCACTTTGG + Intergenic
1201331801 Y:12831501-12831523 TGCTTGTAATCTCAGCACTTTGG + Intronic
1201333806 Y:12857363-12857385 TGCTTATAATCTCAGCACTTTGG - Intronic
1201361777 Y:13159377-13159399 TGCTTGTAATGTCAACACTTTGG + Intergenic
1201430878 Y:13900787-13900809 CCGTTCTCATGTCAGCACTTTGG + Intergenic
1201533356 Y:15017056-15017078 TGCTTGTAATCTCAGCACTTTGG + Intergenic
1202605258 Y:26634203-26634225 TGCCTCTAATCTCAGCACTTTGG - Intergenic