ID: 966297552

View in Genome Browser
Species Human (GRCh38)
Location 3:178441428-178441450
Sequence CTGTTTATAGAGATTTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966297552_966297554 11 Left 966297552 3:178441428-178441450 CCTGCCAAAATCTCTATAAACAG 0: 1
1: 0
2: 0
3: 15
4: 213
Right 966297554 3:178441462-178441484 CTATCTGCAGTAAACTATTTTGG 0: 1
1: 0
2: 0
3: 17
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966297552 Original CRISPR CTGTTTATAGAGATTTTGGC AGG (reversed) Intronic
900756771 1:4440809-4440831 GTTTTTATAGATAATTTGGCAGG + Intergenic
901048001 1:6410311-6410333 CTTTTTAAAAAAATTTTGGCCGG - Intergenic
901735892 1:11311956-11311978 CTGTTTATTGAGAGCTTTGCAGG + Intergenic
902604126 1:17559424-17559446 CTGATTGTAGAGACCTTGGCAGG + Intronic
903547434 1:24134936-24134958 TTGTATATATACATTTTGGCAGG - Intronic
904333096 1:29778324-29778346 CTGTTGATAGACACTTGGGCTGG + Intergenic
907006093 1:50915510-50915532 CTGTTTACAGAGATGATGTCTGG + Intronic
907715876 1:56925586-56925608 CTGTTTATAGAGATAATGGGGGG - Intergenic
907758034 1:57330038-57330060 CTGTTTATAGAGGGGTTAGCAGG + Intronic
908081509 1:60584118-60584140 ATGTTTAAAGAAATTTTGGCTGG - Intergenic
908328104 1:63043707-63043729 CTGTTTTGATAGGTTTTGGCCGG - Intergenic
908557870 1:65275630-65275652 CTGTTTGGAGAGATAATGGCAGG - Intronic
908705385 1:66948435-66948457 CTGTTTATTGAAATCTTGTCAGG + Intronic
910578211 1:88791541-88791563 CTGTTTTTTGAGAGTATGGCTGG + Intronic
917155164 1:171989776-171989798 CTGTTTAAAGTGATTGTGGAAGG + Intronic
917463742 1:175255833-175255855 CTGTTTCTTAAGATTTTTGCAGG - Intergenic
918193664 1:182200735-182200757 CTGTTTCTTGAGATTTTGGAGGG + Intergenic
918654949 1:187013482-187013504 CTGTTTTTAGCCATTTTGGTGGG - Intergenic
921921011 1:220669519-220669541 CTGTTTATGGACATTTAGGTTGG - Intergenic
922586432 1:226737633-226737655 TTGTTTATGGAGCTTTGGGCGGG - Exonic
924216461 1:241827211-241827233 CTTTTTAGAGAGATTTAGGCTGG + Intergenic
1062841483 10:676520-676542 CAGTTCAAAGAGATTTTTGCTGG - Intronic
1063546108 10:6983576-6983598 CTTTTTGTAGAGACGTTGGCCGG - Intergenic
1065110325 10:22434822-22434844 CTGTTTATTGCAATTTTGTCGGG - Intronic
1066547053 10:36511030-36511052 CTGTTTATGGAGATTGGGTCTGG + Intergenic
1066622042 10:37365964-37365986 CTTATTAAAGAAATTTTGGCCGG - Intronic
1067943713 10:50677523-50677545 GTGTTCAGAGAGATTTGGGCTGG + Intergenic
1068037141 10:51775134-51775156 CTGTTTATAGAGCTACTTGCAGG + Intronic
1070315278 10:75304144-75304166 CTGTCTATAAAGATTTAGTCAGG - Intergenic
1074107647 10:110400382-110400404 CTGTTTTTCCATATTTTGGCAGG + Intergenic
1074191687 10:111143528-111143550 CTGTTTATTTAGATTTTGTTTGG + Intergenic
1075139955 10:119823772-119823794 ATGTTTATGGAGAAATTGGCAGG + Intronic
1075434539 10:122425101-122425123 CTGTATATAGAGTTATTGGTGGG + Intronic
1076142687 10:128092190-128092212 ATGTTTATATAGATTTAGGTTGG - Intergenic
1077094335 11:792953-792975 CTGCTTAAAGAGATGCTGGCGGG - Exonic
1077655230 11:4012605-4012627 CAGTTTAAGGAGATTTTGGGCGG + Intronic
1077840937 11:5974071-5974093 CTATTTATACAGGTCTTGGCAGG - Intergenic
1078162902 11:8857276-8857298 CTGTTTTTAGAGATTTGTGGTGG - Intronic
1079776083 11:24529787-24529809 TTGTTTATACAGTTTTTGACAGG - Intronic
1079839180 11:25373448-25373470 ATGTTTAAACAGATTTTGGCAGG + Intergenic
1082282068 11:50280714-50280736 CTGGTTATAGATATTTTCACTGG + Intergenic
1083138948 11:60705597-60705619 CTGTTTATAGAGATTTGATGGGG - Intronic
1086842175 11:91699955-91699977 CATTTTATAGTGATTTTTGCTGG + Intergenic
1087871841 11:103304375-103304397 CTGTTACTAGTGATTTTGGCAGG + Intronic
1088017403 11:105077501-105077523 ATGTTTAAAGATAATTTGGCAGG - Intronic
1088019967 11:105107571-105107593 ATGTTTAAAGATAATTTGGCCGG - Intergenic
1088714391 11:112536052-112536074 CTGTTTACAGAAATGTAGGCAGG - Intergenic
1090475166 11:127013738-127013760 CTCTTTATAGAGGTGTGGGCGGG + Intergenic
1091891912 12:4062994-4063016 CTGTTAATAGATATTTAGGGTGG + Intergenic
1092033195 12:5307111-5307133 CTGTTTTTAGAGATTTTTCCAGG - Intergenic
1092632585 12:10398603-10398625 GGGTTTATAAAGATTTTGGGGGG - Intronic
1093381023 12:18493406-18493428 ATATTTATAGGGCTTTTGGCAGG - Intronic
1094816496 12:34191523-34191545 CTGTTGATAGACATTTTGGTTGG - Intergenic
1097566281 12:61272883-61272905 CTCTTTATAGAAATGTTGACAGG + Intergenic
1097965898 12:65580970-65580992 TTGTTTATAGCCATTTTTGCAGG - Intergenic
1098269649 12:68757524-68757546 CTTTTTATAGATAACTTGGCTGG - Intronic
1100262099 12:92942104-92942126 TTGTTTAAAGGCATTTTGGCTGG - Intergenic
1102251750 12:111392040-111392062 CTATTTTTAAAAATTTTGGCTGG - Intergenic
1102611522 12:114116530-114116552 CCATTACTAGAGATTTTGGCTGG + Intergenic
1102894201 12:116585577-116585599 CAGTTTACAGAGATTTTACCTGG - Intergenic
1104192654 12:126497843-126497865 CTGTTTATTGAGAGTGTGGTTGG - Intergenic
1108982973 13:56543601-56543623 CTGTTTTTATTGTTTTTGGCTGG - Intergenic
1111423580 13:88050609-88050631 CTGTTTATTGTAATTTTGACTGG - Intergenic
1115667558 14:35569808-35569830 TTGTTAATAGAGATATGGGCAGG - Intronic
1115706214 14:36001251-36001273 CTGTTCATAGAGATTATCTCTGG - Intergenic
1116168059 14:41359718-41359740 CTTTTTATTGAAATATTGGCAGG - Intergenic
1116797478 14:49407440-49407462 CTGTTTACAGAGATTTAGCAGGG - Intergenic
1119591073 14:75888464-75888486 CTTTTTTAAAAGATTTTGGCAGG + Intronic
1120981046 14:90289354-90289376 TTGTTTATAGAGATTTCAGCTGG - Intronic
1123448962 15:20348775-20348797 CTGTTTGCAGAGATTTTTGTTGG + Intergenic
1123676367 15:22714118-22714140 CTATTTTTAGGGCTTTTGGCAGG + Intergenic
1124102139 15:26705455-26705477 CTGTTGATGGACATTTGGGCTGG - Intronic
1124328585 15:28788379-28788401 CTATTTTTAGGGCTTTTGGCAGG + Intergenic
1125508386 15:40280359-40280381 CTATTTAAAGAGATATTGTCAGG + Intronic
1125961692 15:43835313-43835335 CTTTTTATAGAGATTGGGGTGGG - Intronic
1126484406 15:49164077-49164099 CTATTTATAGAGATGGAGGCAGG + Intronic
1126509121 15:49446966-49446988 AAGTTTCTAGAGATTTTGACAGG + Intronic
1126935070 15:53697623-53697645 CTATTTATAGAGGTGTGGGCAGG - Intronic
1127270634 15:57398344-57398366 CTGTTAATGGGGATTTTGGATGG + Intronic
1127407761 15:58669718-58669740 CTGTTAATGGACATTTTGGTTGG - Intronic
1130803316 15:87290910-87290932 CTGTTTATAGAGGTGAAGGCAGG + Intergenic
1131461907 15:92623424-92623446 CTTCCTATAGAGATTTTGGTGGG - Intronic
1134824956 16:17277133-17277155 CTGTTTATTGAGTTGTTGGTAGG - Intronic
1136495520 16:30641109-30641131 CTATATATATATATTTTGGCTGG - Intergenic
1137403244 16:48170480-48170502 CTGTTTAAAGAGACCTTGCCTGG + Intronic
1138099890 16:54244187-54244209 CTGTTTACGGAGATGTGGGCAGG + Intergenic
1138908137 16:61363028-61363050 CATTTGATAGATATTTTGGCTGG + Intergenic
1143898672 17:10156837-10156859 CTGTTTATAGAGGCTTGAGCAGG - Intronic
1145853065 17:28122349-28122371 GTGTTTATAGAAATTTAGACAGG + Intronic
1147849490 17:43430799-43430821 CTGTTTAAAGACATTTTGCTTGG + Intergenic
1149013436 17:51881458-51881480 GTGTTTATAGTGACTTTTGCTGG - Intronic
1149567576 17:57650952-57650974 CTGTTTATTGAGTTTGCGGCTGG + Intronic
1152339689 17:79717089-79717111 CTGTTTGCAGAGATTTTTGTTGG - Intergenic
1153853890 18:9125711-9125733 TTGTTTATGGAAATTTTGGAGGG + Intronic
1154256953 18:12790218-12790240 ATGTTTAAAGAGATCTTTGCTGG - Intronic
1156355643 18:36338108-36338130 CTGGTTATTGAGAATGTGGCAGG + Intronic
1157711686 18:49853953-49853975 CTGTTGATGGACATTTTGACAGG - Intronic
1157737182 18:50060323-50060345 TTGGTTCTAGAGAGTTTGGCTGG - Intronic
1159106138 18:64003238-64003260 CTGATTTTAGAGAGTTTGCCTGG + Intronic
1161872699 19:6882575-6882597 CTGTTTATGGAGCTCATGGCAGG + Intergenic
1163480315 19:17551685-17551707 GAGTTAATAGAGATGTTGGCTGG - Intronic
1165584242 19:36899265-36899287 CTGTTTATAGAGATCGGGGGGGG - Intronic
1167064855 19:47177536-47177558 CTGTTTGTACAGATTGGGGCAGG + Intronic
925745978 2:7044136-7044158 CTTTTTAAAGCTATTTTGGCTGG + Exonic
926629982 2:15127390-15127412 CTGTTGAGAGAGAATCTGGCTGG - Intergenic
926907113 2:17816280-17816302 CTGTTTAAAGACATTTTAGCTGG + Intergenic
927738971 2:25549955-25549977 CTGTTTAAAGATATACTGGCTGG - Intronic
933239671 2:79906032-79906054 CTGTTTTTAGAGAATTGGCCAGG - Intronic
936828071 2:116605544-116605566 CTTTTTATAGATAATGTGGCTGG + Intergenic
939734154 2:145822847-145822869 CAGTCTATAGATATTTTGGAGGG + Intergenic
941909553 2:170750293-170750315 TTTTTCACAGAGATTTTGGCTGG - Intergenic
942314436 2:174684308-174684330 CTTTTTAAAGATAATTTGGCAGG - Intergenic
943061075 2:183041961-183041983 CTGTTTATAAAGGTTTGAGCAGG - Intergenic
944375126 2:199032692-199032714 CAGTTTAAGGAGATTTTGGGCGG - Intergenic
945402883 2:209407976-209407998 CTGTTTAAAGATCTTTTTGCTGG - Intergenic
945936631 2:215908979-215909001 CTGTTTTTAGGCATTTTGACGGG - Intergenic
945972807 2:216246676-216246698 CTGATTAGAGCGATTTTTGCGGG - Intergenic
947216506 2:227754897-227754919 CTTTTTAAAGATATTCTGGCTGG - Intergenic
1170188930 20:13625452-13625474 CTATTTTTAGGGCTTTTGGCAGG - Intronic
1172347409 20:34213797-34213819 CTGTTTACAGACATTCTTGCTGG - Intronic
1173255842 20:41393988-41394010 CTTTTTATAAAGAGTTTGGCTGG - Intergenic
1176428296 21:6561903-6561925 CTGGTTATAGATAAGTTGGCTGG - Intergenic
1178241315 21:30904148-30904170 GTTTTTAAAGATATTTTGGCGGG - Intergenic
1178641283 21:34346244-34346266 CCTTTTATAGAGAGTCTGGCTGG + Intergenic
1178734269 21:35134692-35134714 TTCTTTATAGAGTTTTTGGGAGG + Intronic
1178763441 21:35426485-35426507 CTCTTTATGGAGATTTTAGCTGG + Intronic
1178920012 21:36732533-36732555 CTGTCCATAGAGATTTGGGGAGG - Intronic
1179703786 21:43170219-43170241 CTGGTTATAGATAAGTTGGCTGG - Intronic
1181687662 22:24540840-24540862 GTGTTTCTAAACATTTTGGCTGG + Intronic
1182182918 22:28370373-28370395 CTATTTATAGAGGTTTGAGCAGG - Intronic
1183364875 22:37401598-37401620 CTGTTTCTAGTGATTTCTGCAGG - Intronic
950873094 3:16246062-16246084 CTTTTTCAAGAGATTATGGCTGG + Intergenic
951009235 3:17657179-17657201 CTGTATATAGAGATATACGCAGG - Intronic
952648352 3:35690347-35690369 CTGTTTATAGCCATTTTGTCAGG - Intronic
954345866 3:49998809-49998831 CCTTTTATAAAGATTTTAGCTGG + Intronic
956634753 3:71352759-71352781 CTGTTTATTGAGATTTTTTAGGG + Intronic
956696961 3:71926703-71926725 CTGTTTCTAAAGATGTGGGCAGG + Intergenic
956811039 3:72864314-72864336 CTACATATAGAAATTTTGGCTGG + Intergenic
957968901 3:87358153-87358175 ATATTTATAGAGATTATGTCAGG + Intergenic
958178241 3:90023828-90023850 CTATTTCCAGAGATGTTGGCAGG - Intergenic
959068203 3:101678464-101678486 CTGTCTTTAAATATTTTGGCCGG + Intergenic
960029501 3:113043058-113043080 CTGCTTACAGAGATATAGGCAGG + Intergenic
960405488 3:117254069-117254091 CTCATGAAAGAGATTTTGGCTGG + Intergenic
962027616 3:131565202-131565224 ATTTTTAAAGAGATTTTTGCTGG - Intronic
963574595 3:147044027-147044049 CTGTTTAAAAATATTTTGCCTGG + Intergenic
965876174 3:173323628-173323650 CTGCTTTTAGAAAATTTGGCTGG + Intergenic
966297552 3:178441428-178441450 CTGTTTATAGAGATTTTGGCAGG - Intronic
966298349 3:178450195-178450217 CTGTTTATAAAGCTTTTCTCTGG + Intronic
968710187 4:2109075-2109097 ATGATTATAGAAATTTTGGAAGG + Intronic
972434078 4:39014895-39014917 CTGTTTCTTGAAAGTTTGGCAGG + Intronic
974618337 4:64320677-64320699 CTGTTTACAGAAATTGTGTCAGG - Intronic
975127741 4:70801045-70801067 CTTTTTATAGTTATTTTAGCAGG + Intronic
976852116 4:89559596-89559618 CAATTTACAGAGAATTTGGCAGG + Intergenic
977363479 4:96036215-96036237 TTTTTTATAGACTTTTTGGCTGG + Intergenic
978039207 4:104037867-104037889 CAATTTACAGAGGTTTTGGCAGG - Intergenic
982574259 4:157089091-157089113 CTTTTAATAAAGATTTCGGCTGG + Intronic
982722221 4:158870570-158870592 TTGTTTATGGAGATGTGGGCAGG + Intronic
983256086 4:165402366-165402388 GTGTTTCTAGTGATTCTGGCCGG + Intronic
984746268 4:183221992-183222014 CTATTGATAGACATTTAGGCTGG - Intronic
985392863 4:189509639-189509661 CTGAATATAGATATTTTGGTTGG + Intergenic
986365571 5:7026714-7026736 TTAATTATAGAGATTTTGGTAGG - Intergenic
987746144 5:21974618-21974640 CTGTAAATAGAGATTCTGGAAGG - Intronic
990039427 5:51361603-51361625 CTGTTTCTTGAGTTCTTGGCGGG - Intergenic
990303493 5:54472591-54472613 TTATTTATAGAGATGTGGGCAGG - Intergenic
991766350 5:69984728-69984750 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991780968 5:70133425-70133447 CTGTAAATAGAGATTCTGGAAGG + Intergenic
991845583 5:70859811-70859833 CTGTAAATAGAGATTCTGGAAGG - Intergenic
991873414 5:71133739-71133761 CTGTAAATAGAGATTCTGGAAGG + Intergenic
993272871 5:85817484-85817506 GTTTTTAAAGATATTTTGGCAGG - Intergenic
993526827 5:88975525-88975547 ATGATTATAGAAATATTGGCCGG + Intergenic
994899530 5:105753114-105753136 CAGTTTTTAGATATTTTGGGGGG + Intergenic
995644630 5:114297614-114297636 CTGTATTTAGAGTTTTTGGAGGG - Intergenic
996160286 5:120153643-120153665 TTGTTTATAGGGATTCTTGCTGG + Intergenic
999032899 5:148314299-148314321 CAGCTTATAGAGATTTAAGCTGG - Intronic
1005278372 6:24244071-24244093 CTGTTTAGAGATCTTTTGGGTGG - Intronic
1008421310 6:51302785-51302807 CTGGTTATAAAGACTTTGGAAGG + Intergenic
1008728411 6:54450427-54450449 CTATATATAGGGGTTTTGGCTGG - Intergenic
1008969478 6:57350134-57350156 CTGTTTACAGATTTTTTGGTGGG + Intronic
1009158450 6:60251966-60251988 CTGTTTACAGATTTTTTGGTGGG + Intergenic
1009669169 6:66723439-66723461 TTGTTTATAGACATTAAGGCAGG - Intergenic
1010121871 6:72385862-72385884 CTGTTTATTGAGCTTCTGCCTGG + Intronic
1012409783 6:98943816-98943838 CTGTTTAGTGATTTTTTGGCTGG - Intronic
1012563817 6:100620571-100620593 CTGTCTATAGATATTTGGGCTGG - Intronic
1014760400 6:125350341-125350363 CTGGTTGTAGAGATTTTAACTGG + Intergenic
1016591675 6:145752562-145752584 CTTTTTAAAGACATTTTGGAGGG + Intergenic
1017410627 6:154163942-154163964 TTGTTTATAGAAAGTTAGGCAGG + Intronic
1022304427 7:29132999-29133021 CTGTGTGAAGACATTTTGGCTGG - Intronic
1022649077 7:32258528-32258550 TTGTTAATGGAGAATTTGGCAGG - Intronic
1024130177 7:46343793-46343815 CTGAATATAGATTTTTTGGCTGG + Intergenic
1024409725 7:49026413-49026435 CTTTTTAAGGAAATTTTGGCAGG - Intergenic
1025092130 7:56072987-56073009 GTCTTTATAGGGATTTTGTCAGG + Exonic
1027990662 7:85356356-85356378 CTGTTTTTTGATATTTTTGCAGG + Intergenic
1028321746 7:89467714-89467736 TTGTTTATAGACGTTTTGGATGG + Intergenic
1028474653 7:91239999-91240021 CTGTTTATTTAGCCTTTGGCTGG - Intergenic
1028743941 7:94306754-94306776 TTGGTTACAAAGATTTTGGCAGG - Intergenic
1031054528 7:116978933-116978955 CTATTTACAGAGGTATTGGCAGG + Intronic
1031377782 7:121049174-121049196 CTATTTACAGAGGTTTTGGCAGG + Intronic
1031465347 7:122103336-122103358 CTGTGTATAGTATTTTTGGCTGG - Intronic
1034717997 7:153261498-153261520 CTGTTTACAGTGATTTTCCCTGG - Intergenic
1036826949 8:11984488-11984510 CGTTTTTTAGACATTTTGGCCGG - Exonic
1037110033 8:15154800-15154822 CTTTTTATACAAATTCTGGCAGG - Intronic
1037357491 8:18037547-18037569 GTGTATATATATATTTTGGCTGG + Intergenic
1039196314 8:35035355-35035377 CTGTTTGCAAAGATGTTGGCAGG - Intergenic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1040393421 8:46970674-46970696 CATTTTATAGAAATATTGGCCGG + Intergenic
1040873484 8:52125262-52125284 ATTTTTATAGAGATTCTGGAAGG - Intronic
1041267430 8:56078598-56078620 CTGTTTTTAGGCATTTAGGCTGG + Intergenic
1041440256 8:57887536-57887558 ATGGTTTTAGAGATGTTGGCTGG + Intergenic
1041583579 8:59491014-59491036 CAGCTTAAAGAGATTTTGGGTGG + Intergenic
1042543743 8:69932505-69932527 CAGTTAATAGAGGTTTTAGCTGG + Intergenic
1044207474 8:89508347-89508369 TAGTTTGTAGAGATTTTGTCTGG - Intergenic
1047615593 8:126559897-126559919 AGGCTTATAGAGATTATGGCTGG + Intergenic
1050176906 9:2877779-2877801 CTTTATATGGAGATTCTGGCAGG + Intergenic
1051445656 9:17136091-17136113 CTGTTTGTAGAGTTTTTGTAAGG + Intronic
1052280534 9:26728262-26728284 TTGTTTGTAGAGAGTTTGTCAGG - Intergenic
1055483148 9:76730181-76730203 CAGTCTAGAGAGTTTTTGGCTGG + Intronic
1057143358 9:92741263-92741285 CTGTTTGCTGAGATTTTGTCAGG - Intronic
1059080337 9:111242416-111242438 CTGTTGATAGAGCTTTCTGCTGG + Intergenic
1059384762 9:113955571-113955593 ATATTTATAGAGATTGTGGTTGG + Intronic
1185703311 X:2247936-2247958 CTATTTATAGGGTTTCTGGCTGG - Intronic
1186874079 X:13799879-13799901 ATGTTTATACAGACTGTGGCAGG + Intronic
1187694701 X:21907476-21907498 CTATTCACAGAGACTTTGGCAGG + Intergenic
1191141835 X:57122678-57122700 TTGTTTACAGAGTTTTTGGTTGG - Intergenic
1192622913 X:72697686-72697708 TTGTTTAAAAAAATTTTGGCCGG + Intronic
1193133019 X:77938019-77938041 CTGATAATATAGATTTTGGGAGG - Intronic
1196965858 X:121054170-121054192 CTGCTTGCAGAGCTTTTGGCGGG + Intergenic
1197165308 X:123370586-123370608 TTGTTTATAGAGATTTCAGTGGG + Intronic
1197957228 X:131964708-131964730 CTGCTTAAGGAGATTTTGGGCGG - Intergenic
1199166730 X:144685108-144685130 CTGTTTACCGAGGTTTTGACTGG + Intergenic