ID: 966300713

View in Genome Browser
Species Human (GRCh38)
Location 3:178476658-178476680
Sequence TTGGAGAAGTGAAGAAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 362}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966300713_966300725 30 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300725 3:178476711-178476733 TTGGTAGTTTGGGGAGGGAGAGG 0: 1
1: 0
2: 4
3: 50
4: 584
966300713_966300723 24 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300723 3:178476705-178476727 CGACAATTGGTAGTTTGGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 47
966300713_966300724 25 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300724 3:178476706-178476728 GACAATTGGTAGTTTGGGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 149
966300713_966300719 11 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300719 3:178476692-178476714 TGAAATAGGTGAACGACAATTGG 0: 1
1: 0
2: 0
3: 9
4: 118
966300713_966300721 20 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300721 3:178476701-178476723 TGAACGACAATTGGTAGTTTGGG 0: 1
1: 0
2: 0
3: 6
4: 68
966300713_966300720 19 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300720 3:178476700-178476722 GTGAACGACAATTGGTAGTTTGG 0: 1
1: 0
2: 0
3: 2
4: 44
966300713_966300715 -3 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 7
4: 98
966300713_966300722 21 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300722 3:178476702-178476724 GAACGACAATTGGTAGTTTGGGG 0: 1
1: 0
2: 2
3: 1
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966300713 Original CRISPR TTGGAGAAGTGAAGAAAGCG TGG (reversed) Intronic
900840500 1:5045392-5045414 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
901495191 1:9617040-9617062 TTGGAGAGGTGAAGAGAGGCAGG + Intergenic
903749785 1:25614464-25614486 TTAGAGAAGTGAGGAAGCCGTGG + Intergenic
906010944 1:42525213-42525235 TTGAAGAAGTGAAGAAATAATGG - Intronic
906021272 1:42631705-42631727 TTGGAAACGGGAAGAAAGAGTGG - Intronic
906462372 1:46044814-46044836 TTGGTGAAATGAAAAAAGCCTGG + Intronic
908205104 1:61839003-61839025 TTTTAGAAGTGAAGAAACTGAGG + Intronic
908689088 1:66756926-66756948 TGGAAGAAGTGAAGAAAGCCAGG - Intronic
909648945 1:77951964-77951986 TTGGAGAAGTGAAGACATTTGGG - Intronic
910501748 1:87900410-87900432 TTGAAGAAATGAAAAAAGAGGGG - Intergenic
910733182 1:90421176-90421198 TTGGAAAAGGGAGGAAAGAGTGG + Intergenic
910948248 1:92616999-92617021 CTGGAGAAGAGAAGACAGGGTGG - Intronic
910951274 1:92651353-92651375 TTGGAGAAAAGGAGAAAGAGAGG + Intronic
910971735 1:92862759-92862781 TTGCAGAGGTGAAGGAAGCAGGG - Intronic
911760000 1:101602916-101602938 TTGGAGAAGAGAATAAAGAGGGG + Intergenic
912418568 1:109528470-109528492 TTGGAACAGTGAAGACAGCTGGG - Intergenic
912813343 1:112810237-112810259 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
912815558 1:112825482-112825504 TTGGAGAAGAGAGTAAAGAGGGG + Intergenic
913172382 1:116244438-116244460 TAGGAGTGGTGAAGAAAGGGAGG - Intergenic
915082589 1:153362140-153362162 TTTCATAAGTGAAGAAACCGAGG + Intergenic
915165684 1:153946617-153946639 TTGGGGGAGTAGAGAAAGCGGGG - Exonic
915367070 1:155322667-155322689 ATGGAGAAGTGACGTCAGCGAGG + Exonic
916478536 1:165193579-165193601 TTGGAGAGGGAAAGAAAGTGTGG + Intergenic
917076357 1:171209348-171209370 TTGGTGAACTGAGGGAAGCGTGG - Exonic
917626369 1:176850638-176850660 TTGGAGATGTGAAGGGAGTGAGG + Intergenic
917662296 1:177189026-177189048 TTGGAGAGGTAAAGAAGGCCAGG + Intronic
918354668 1:183696234-183696256 TTTGAGATGGGAAGAAAGCCAGG - Intronic
919352188 1:196471324-196471346 TTGAAGAAGTGTAGAAAGAGTGG + Intronic
920848738 1:209614294-209614316 TTGGATAAGTGAGGAAACCAAGG - Intergenic
921156455 1:212442689-212442711 TTGGAGGTGTGAGGAAAGGGAGG + Intronic
922416308 1:225426621-225426643 TTGGAGAAGTGAAGGAAAGATGG - Intronic
922877024 1:228948012-228948034 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
923021349 1:230166704-230166726 TGGGAAAAGGGAAGAAAGCAAGG - Intronic
924137059 1:240979526-240979548 TTTGAGAAGTGGAAAAATCGGGG + Intronic
924142395 1:241039211-241039233 TAGGAAAAGTGAAGAATGGGAGG - Intronic
1063164221 10:3445151-3445173 TGGGAGAAATGAAGAACCCGGGG + Intergenic
1064967535 10:21030226-21030248 CTGGCGAAGTGAAGAAACCCAGG + Intronic
1064980989 10:21166514-21166536 TTTGAGGGGTGAAGAAAGAGTGG - Intronic
1065346369 10:24751588-24751610 TTGGAAAACTGAAGAAAGAGAGG - Intergenic
1065612578 10:27486822-27486844 TTTTACAAGTGAAGAAATCGAGG + Intergenic
1068021428 10:51590276-51590298 TTGCACAAGTGAAGAAACTGAGG + Intronic
1068695442 10:59963530-59963552 TTGGACAAGTGAGGAAACTGAGG + Intergenic
1070481210 10:76884524-76884546 TGGGGGAAGTGAAGGAAGCTGGG + Intronic
1070770624 10:79080271-79080293 TGGGAGAAGAGCAGAAAGCTCGG + Intronic
1071466078 10:85940861-85940883 TTGGAGAGGAGAAGAGACCGAGG + Intronic
1071523629 10:86345924-86345946 TTGGTCAGGTGAAGAAAGGGAGG - Intronic
1071736418 10:88305503-88305525 ATGGAAAAGAGAAGAAAGCAGGG + Intronic
1072091284 10:92130066-92130088 TTGGAGAAATGAAGGAAGTGTGG - Intronic
1072253209 10:93598112-93598134 TTTTAGAAGTGAAGAAACTGGGG - Intronic
1073612369 10:104957163-104957185 TGCGGGAAGTGAAGAAAGCAAGG + Intronic
1074649864 10:115508678-115508700 TTGTAGAATTGAAGAAAGTTAGG - Intronic
1076071322 10:127492288-127492310 CTGGAGAAGTAGAGAAAGCGAGG - Intergenic
1077679387 11:4224692-4224714 TTGGAGAAGAGAATAAAAAGAGG + Intergenic
1078130942 11:8613649-8613671 TGGGAGCAGTGGAGTAAGCGAGG + Exonic
1078518237 11:12043137-12043159 ATGTAAAACTGAAGAAAGCGGGG + Intergenic
1078822050 11:14892172-14892194 TTGGAGAGCTGAAGAGGGCGCGG - Exonic
1079340327 11:19606451-19606473 ATGGAGAAGTGAGGTCAGCGAGG - Intronic
1080537168 11:33233113-33233135 TTGGAGAAATGAAGAAAAAAGGG + Intergenic
1080556310 11:33420614-33420636 AGGGAGAAGTGAAGAGAGTGAGG + Intergenic
1080867797 11:36210918-36210940 ATGGAGAAATGAAGAAATCAAGG - Intronic
1080884207 11:36350369-36350391 GTGGAGAAGTGAAGAATAAGAGG + Intronic
1081908948 11:46687923-46687945 TTTGAAAGGTGAGGAAAGCGAGG + Intronic
1082122695 11:48396426-48396448 TTGGAAATGGGAAGAAAGAGTGG - Intergenic
1084045208 11:66564257-66564279 TAGGAAAAGAGCAGAAAGCGAGG + Intronic
1084979925 11:72823575-72823597 TTGGGGCAGTGAAGAAACCGTGG + Intronic
1086637995 11:89114778-89114800 TTGTAGAACTGAAGAAAGTTAGG - Intergenic
1086844140 11:91727389-91727411 TTGGAGAGACGAAGAAAGGGTGG + Intergenic
1087093130 11:94295725-94295747 TGGGTGAAGTGAAGAAACCTAGG - Intergenic
1088196044 11:107274849-107274871 TTGGAGAGATGAAGAAAGAGTGG - Intergenic
1088454436 11:110018929-110018951 TTGGATAGGTGAAGTAAGGGGGG - Intergenic
1088763198 11:112951236-112951258 TTGGAGAAATAAAGATAGCAGGG + Intergenic
1089000484 11:115047903-115047925 TTTGAGATGTGAAGAAGGCAAGG - Intergenic
1089832118 11:121337994-121338016 TTTGAGAGGGGAAGAAAGAGAGG + Intergenic
1090184277 11:124726022-124726044 TTGGAGAAGAGAAGACCGAGAGG - Intergenic
1091263796 11:134254108-134254130 TTAGAGAAGTGAAGAAACTTGGG + Intronic
1091270821 11:134310709-134310731 GTGGAAAAGTGAGGAAGGCGTGG + Intronic
1091620233 12:2082170-2082192 TTAGAGAAGTGATGAAACTGTGG + Intronic
1091801169 12:3325539-3325561 TTCGAGAGGTGAAGAAACTGAGG - Intergenic
1091810324 12:3391530-3391552 TTGGAGAAGTGACCAGAGCTAGG + Intronic
1092446594 12:8563554-8563576 AGGGTGAAGTGAAGAAAGCAAGG + Intergenic
1093306988 12:17532765-17532787 TTATAGAATTGAAGAGAGCGGGG - Intergenic
1093535292 12:20216277-20216299 TTGGAGAAGAGAAAGAAGCGTGG + Intergenic
1094409208 12:30151176-30151198 TTGGACAAGTGAAGCAACCTGGG + Intergenic
1095310091 12:40688490-40688512 CTGGAGAAGTGAGGAAACGGTGG + Intergenic
1095475738 12:42585725-42585747 TTGGAGCAGTGAAAAAAGCCTGG - Intronic
1095523751 12:43099767-43099789 TTGGAGAAGTGCTGTAAGAGAGG - Intergenic
1095637446 12:44450620-44450642 TTGGAGAAGAGAGTAAAACGAGG - Intergenic
1098094852 12:66944504-66944526 CTGCAGCAGTGAAGAAAACGTGG + Intergenic
1098401937 12:70085884-70085906 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
1099709671 12:86207173-86207195 TTTTAGAAGTGAAGAAAGAGAGG + Intronic
1099828522 12:87810774-87810796 TTGTAGAAATGAAGAAAAGGAGG - Intergenic
1099836329 12:87912309-87912331 TTGGAGAAGAGAGTAAAGAGAGG + Intergenic
1101379481 12:104202108-104202130 TTGGAGACTTGGAGAAAGGGTGG - Intergenic
1103009241 12:117445334-117445356 TTTGAGAGGTGAAGAAACTGAGG - Intronic
1106203196 13:27562078-27562100 TTTTAGAAGTGAGGAAAGGGAGG - Intronic
1106467541 13:30026229-30026251 GTGGAGTAGTGAAGAACACGTGG + Intergenic
1107080157 13:36366191-36366213 TAGAAGATGTGAAGAAAGAGAGG - Intronic
1107392492 13:39981811-39981833 CTGGAGAGGTGGAGAAAGAGAGG - Intergenic
1108079360 13:46718357-46718379 TTAGAGAAATGAAGAAACTGAGG + Intronic
1108479338 13:50852331-50852353 ATGGAGAAATGAAGCAAACGTGG - Intergenic
1108733621 13:53259908-53259930 ATGGAGAATGGCAGAAAGCGAGG + Intergenic
1108793443 13:54001345-54001367 TTTGCCAAGTGAAGAAAGCAAGG - Intergenic
1108793446 13:54001421-54001443 TTTGCCAAGTGAAGAAAGCAAGG - Intergenic
1109077330 13:57853020-57853042 TGGGACAAGTGAAGAAACTGAGG - Intergenic
1109325400 13:60861281-60861303 TTGGAGAGGTGAAGGAAGAGGGG + Intergenic
1112678585 13:101734768-101734790 TTTTAGAACTGAAGAAACCGAGG + Intronic
1114391794 14:22317103-22317125 TTGGAGAAATGAAGAGGGTGGGG + Intergenic
1114703371 14:24701307-24701329 ATGGAAAAGAGAAGAAAGAGTGG - Intergenic
1115666273 14:35552176-35552198 TTTCAGAAGTAAAAAAAGCGGGG - Intronic
1117247369 14:53899647-53899669 TTGGACAAGTGATCAAAGCCTGG + Intergenic
1117909587 14:60624307-60624329 TGGGAGAGGTGGAGAAAGAGGGG - Intergenic
1118682766 14:68260317-68260339 GTGGAGAGGGGAAGACAGCGGGG + Intronic
1119810820 14:77517667-77517689 ATGGAGATGTGAAGAATGAGTGG + Intronic
1120191959 14:81447687-81447709 TTTCAGAAATGAAGAAACCGAGG - Intergenic
1120391384 14:83912679-83912701 ATGGAGAAAGGAAGAAAGAGAGG + Intergenic
1120820595 14:88908408-88908430 TTGAAGAACAGAAGAAAGAGAGG + Intergenic
1121289144 14:92760355-92760377 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
1123780291 15:23620376-23620398 GTGGAAAAGTGAAGAAAGACAGG - Intronic
1124808814 15:32913549-32913571 ATGGAGAGATGAAGAAAGGGAGG - Intronic
1125005863 15:34816935-34816957 CTGGAGAAGAGAAAAAAGGGGGG + Intergenic
1125870574 15:43097742-43097764 TCGGAGAACTGAAGAGAGTGAGG + Intronic
1125968918 15:43896306-43896328 TTGGAGAAGTGAAGTCACAGAGG - Intronic
1126222653 15:46232269-46232291 CTGGGGAAGTGAACAAAGAGTGG + Intergenic
1126343900 15:47673406-47673428 TTGGAGAAGGGAAGGAGGAGGGG - Intronic
1126503836 15:49380107-49380129 TTGGAAAGGGGAAGAAAGAGAGG - Intronic
1130220741 15:82017576-82017598 TTGGACAAATGAATAAAGAGGGG + Intergenic
1131295468 15:91144717-91144739 TAAGAGAAGTGGAGAAAGCATGG - Intronic
1131553507 15:93377569-93377591 TTGGGAAAGTGGAGAAAGGGAGG + Intergenic
1132421395 15:101672949-101672971 TTGGAGAAGAGGATAAAGCAGGG + Intronic
1132692866 16:1189331-1189353 TTGGAGATGTGAGGAAGGGGAGG + Intronic
1133492718 16:6286216-6286238 TTGGAGAAGAGAAGAAACCAGGG - Intronic
1133587032 16:7205591-7205613 TTGTAGAAGTGAAAACAGGGTGG - Intronic
1135616645 16:23916694-23916716 ATTGTGAAGTGAAGAAAGCAAGG - Intronic
1135680424 16:24452171-24452193 TTGGAGACATAAAGAAAGCCAGG + Intergenic
1137289567 16:47042694-47042716 TATGAGAAAAGAAGAAAGCGAGG - Intergenic
1137363219 16:47839316-47839338 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1137788876 16:51157738-51157760 TTGGGGAAGTGAGGAAAGCCAGG - Intergenic
1137835955 16:51592836-51592858 TTGTACAAGTAAAGAGAGCGTGG - Intergenic
1138916613 16:61471968-61471990 TTGGAAAGGTGAAGAAAGAGTGG + Intergenic
1140181381 16:72722546-72722568 CTGGTGTAGTGAGGAAAGCGTGG + Intergenic
1140334723 16:74094709-74094731 TTGGGGAAGTGAAAAAAGGAAGG - Intergenic
1140510917 16:75507869-75507891 TTGGAGACCTGAAGGAAGCGAGG + Intergenic
1140877149 16:79163201-79163223 TGGGAGGAGGGAAGAAAGTGAGG + Intronic
1140984240 16:80142457-80142479 TTGAAGAATTGAACAAAGGGAGG - Intergenic
1141506160 16:84480027-84480049 CTTGAGAAGAGAAGAAAGGGTGG + Intronic
1143772635 17:9178424-9178446 GTGGAGAAGAGAAGAATGTGAGG - Intronic
1145401710 17:22543000-22543022 TTGGAAAAATGAAGAAAGAAAGG + Intergenic
1145805372 17:27723787-27723809 TTTGAGAAGAGAAGACAGGGAGG - Intergenic
1146174851 17:30659362-30659384 TTGTAGAAGGGAAGAAAGAATGG + Intergenic
1146348305 17:32075386-32075408 TTGTAGAAGGGAAGAAAGAATGG + Intergenic
1146466381 17:33089955-33089977 TTGGAGAAGACAAGACAGAGAGG - Intronic
1146933694 17:36796419-36796441 GTGGAGAAGGGAAGAAAGAAAGG + Intergenic
1148955597 17:51351178-51351200 TTTGAGAATTGAACAAAGCCCGG + Intergenic
1149370252 17:55986984-55987006 ATGGGGAAGTGAAAAAAGTGGGG - Intergenic
1150606523 17:66696072-66696094 ATGGAGCAGTGATGAAAGCAGGG + Intronic
1150802636 17:68293950-68293972 CTGGAGAAGTTAAAAAAGCAGGG - Intronic
1151077575 17:71291199-71291221 TTGCAGAAGTAAGGAAAGTGCGG + Intergenic
1151319385 17:73343420-73343442 GGCGAGAAGAGAAGAAAGCGAGG + Intronic
1151398338 17:73839659-73839681 TGTGAGAAGTGGAGAAAGAGCGG + Intergenic
1151897806 17:76991999-76992021 TTGGAAATGTGGAGACAGCGTGG + Intergenic
1153018621 18:606710-606732 TTGGAGAAGAAAAGAAAAAGAGG + Intronic
1156237132 18:35216567-35216589 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1156573620 18:38286595-38286617 TTGGAGAAGTGAGGAGATAGAGG - Intergenic
1156641540 18:39106952-39106974 TTGGAGATGTGAATAAGGCCTGG + Intergenic
1156653919 18:39260784-39260806 GTGGAGAACAGAAGAAAGCAAGG + Intergenic
1156938340 18:42737595-42737617 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
1159511641 18:69402382-69402404 TTGGAGAAGGGGAAAAAGAGGGG + Intronic
1159686412 18:71426193-71426215 ATGGTTAAGTGAAGATAGCGTGG + Intergenic
1160129207 18:76209330-76209352 TTGGAGAAGGGAAGAAGGGGTGG + Intergenic
1162987548 19:14280644-14280666 TTGTAGAAGGGAAGAAAGAATGG - Intergenic
1164219118 19:23177537-23177559 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
1164520889 19:28978328-28978350 TTGGAGAAGTGGAGAAAGTTAGG + Intergenic
1165248980 19:34514653-34514675 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1165587217 19:36929241-36929263 TCTTAAAAGTGAAGAAAGCGAGG + Intronic
1167919063 19:52767306-52767328 TGGGAGTAGTGAAGAATTCGGGG + Exonic
1168724515 19:58573358-58573380 GTAGAGAAGTGAGGAAAACGTGG - Exonic
926464359 2:13169085-13169107 TTGGAGAAGAGAATAAAAAGAGG + Intergenic
926705681 2:15835840-15835862 TTGGAGAACTGAAGCCAGGGAGG - Intergenic
927133954 2:20083169-20083191 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
927789871 2:26001697-26001719 CAGGAGAAGAGAAGAAAGAGTGG - Intergenic
927894390 2:26772064-26772086 CTGGAGATGTGGAGAAAGAGGGG - Intronic
929058892 2:37903322-37903344 CTGGAGAAGTGAAGAGACTGGGG - Intergenic
929355163 2:41014863-41014885 TTTGAGATATGAAGAAAGAGTGG + Intergenic
929645682 2:43624936-43624958 GTGGGGAAGTGAAGAAGGGGTGG - Intergenic
929814749 2:45221755-45221777 TTGGAGAAGCGAACCCAGCGAGG + Intergenic
930449089 2:51511405-51511427 TTGGGGAAGTGGAGAAACCAAGG - Intergenic
931322504 2:61184877-61184899 ATGGAGAACTGAGGACAGCGAGG + Intronic
931569822 2:63656910-63656932 TTGGTGAAATGAACAAAGTGGGG + Intronic
931989861 2:67779203-67779225 TTGGAAAAGGGAGGAAAGAGCGG + Intergenic
932008946 2:67956040-67956062 ATGAAGAAGTGAGGAAAGTGAGG + Intergenic
933201543 2:79455854-79455876 TTGGAGAAGTGAGAAAAACTAGG + Intronic
933209201 2:79546852-79546874 TTGAAGAAGTTAAGGAAGCTGGG + Intronic
935006227 2:99080270-99080292 TTTGAGAAGTGAAATAAGTGAGG - Intronic
935251344 2:101264584-101264606 TTGCAGAAGTGAGGAAAGCCTGG - Intronic
937269011 2:120635548-120635570 TTAGAGAACAGAAGAGAGCGAGG - Intergenic
937427983 2:121815688-121815710 TTGGAGAACTGCACAAAGCCTGG + Intergenic
937580984 2:123487730-123487752 TTTGAGAAGTGAAAAAAATGTGG + Intergenic
939531244 2:143364617-143364639 TTGGAAAAATCAAGAAAGCTTGG + Intronic
939770616 2:146311523-146311545 TTGGAGAATTGGAGAAAAAGAGG - Intergenic
940025421 2:149201940-149201962 TTGTACAAGTGAGGAAACCGTGG - Intronic
940107106 2:150113326-150113348 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
940184771 2:150971786-150971808 TTGTAGAAATGAAGAAAGTTAGG + Intergenic
941031362 2:160515546-160515568 TAGGGGAAGTGAAGAAAATGAGG + Intergenic
943061335 2:183044636-183044658 TTGGAGAAGAGAGTAAAGAGTGG - Intergenic
944890413 2:204111256-204111278 TTGGAGATAGGAAGAAAGCCCGG - Intergenic
946731544 2:222714569-222714591 TTGGAGCAGTGAATAAGGCAAGG + Intergenic
1171230800 20:23482709-23482731 TTGGAGATGTGAAAAAAACCTGG + Intergenic
1172166500 20:32902940-32902962 TGGCAGAAGTGAAGGAAGAGGGG - Intronic
1172872087 20:38142203-38142225 TTGGAGAGGAGTGGAAAGCGGGG + Intronic
1173207382 20:41005748-41005770 TTGAAGAAGTGGAGAAACTGAGG + Intergenic
1173665343 20:44759037-44759059 TTAGAGAAGTGAAGGGAGTGGGG - Intronic
1174431592 20:50473774-50473796 TTGGGGAAGTGGAGAGAGAGGGG - Intergenic
1174620773 20:51872926-51872948 TTTGACAGGTGAAGAAACCGAGG + Intergenic
1174868622 20:54162866-54162888 TTAGAGCAGAGAAGAAAGAGAGG + Intronic
1178110274 21:29363266-29363288 TTGGAGACGTGAAGCAAGTCAGG - Intronic
1178678358 21:34649919-34649941 TTGGCCAAGGGTAGAAAGCGGGG - Intergenic
1180078757 21:45476431-45476453 TTCCAGAAGTGAAGAAGTCGAGG + Exonic
1183088610 22:35505308-35505330 TTGGGGAAGGGCAGAGAGCGTGG + Intergenic
1183750306 22:39716252-39716274 TTCGACAAGTGAGGAAACCGAGG - Intergenic
949130326 3:492374-492396 TTGAAGATGTGGAGAAAGAGAGG + Intergenic
949263005 3:2124179-2124201 TTGGAGAGGTGATGAGAGTGAGG + Intronic
949670864 3:6398197-6398219 TTGGAGAAGTGAGTAAAAAGAGG - Intergenic
950098087 3:10341744-10341766 TTGGAGAGGAGAGGAGAGCGGGG - Intronic
951763032 3:26165295-26165317 TTGGAGAAGAGAGTAAAGAGAGG + Intergenic
953135405 3:40177416-40177438 TTGGAGAACTGAAAAAGGGGAGG - Intronic
953283456 3:41581158-41581180 TTGGGGGAGTGAAGAAAGATAGG - Intronic
953705704 3:45228304-45228326 TTTGAGAACAGAAGATAGCGAGG + Intergenic
954627470 3:52030432-52030454 TTGGGGCAGAGAAGAAAGCCAGG - Intergenic
954690556 3:52393304-52393326 GTGGAGAAGTGATGGCAGCGCGG - Intronic
956734592 3:72228465-72228487 TTGGGGGAGTTAAGAAAGCAGGG - Intergenic
957886082 3:86289566-86289588 TTGGAGACGTGAAAATAGAGAGG - Intergenic
959001215 3:100966324-100966346 CTGGTGAAGTGAAGGAAGTGAGG + Intronic
959210183 3:103368987-103369009 TGAGAGAAGTGAAGAAGGTGGGG - Intergenic
960147199 3:114216202-114216224 TTGGAGATTTGAAGAGAGAGAGG + Intergenic
960324846 3:116283163-116283185 TTAGAAAAGTAAAGAAAGAGAGG + Intronic
961343795 3:126247920-126247942 TTGGAGAAGAGAATAAAAAGAGG - Intergenic
961656856 3:128447417-128447439 TTGGGGAACTGAAGGAAGTGAGG - Intergenic
963112058 3:141696126-141696148 TTGGAGAAGAGAATAAAAAGAGG + Intergenic
963456957 3:145556334-145556356 TTGGAGAAGAGAATAAAAAGAGG + Intergenic
965380677 3:167983598-167983620 TTGGAAAGGAGAAGAAAGAGTGG + Intergenic
966300713 3:178476658-178476680 TTGGAGAAGTGAAGAAAGCGTGG - Intronic
966397430 3:179517637-179517659 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
966712417 3:182983220-182983242 TAGGAGAATTGGAGAAAGCAAGG - Intronic
966728786 3:183133037-183133059 TTGGAGAAAAGAAGACAGAGGGG + Intronic
968769222 4:2493230-2493252 TTGGCCAAGTAAAGAAAGGGAGG + Intronic
970799272 4:19952345-19952367 TTGGAGAGAGGAAGAAAGCCGGG + Intergenic
971251312 4:24975463-24975485 GAGGGGAAGAGAAGAAAGCGGGG + Intronic
974524443 4:63029725-63029747 TTGGACTACTCAAGAAAGCGCGG - Intergenic
977225640 4:94388689-94388711 TTGGAGAAGAGAGTAAAGAGAGG + Intergenic
977279683 4:95024372-95024394 TAGGAGAATTCTAGAAAGCGGGG - Intronic
977782728 4:100996900-100996922 TTGGAGAAGGGAGTAAAGAGAGG + Intergenic
978489953 4:109302210-109302232 TGGGAGGAGAGAAGAAAGCGGGG - Exonic
981282892 4:142980440-142980462 TTGGAGAATTGAAAAAAGTCAGG + Intergenic
981329264 4:143488966-143488988 TTGGAAAGGGGAAGAAAGAGTGG + Intergenic
981558176 4:146017937-146017959 TGGGGGAAGGGGAGAAAGCGAGG - Intergenic
982782410 4:159505103-159505125 TTGGAGAAGGGAAAGAAGGGAGG - Intergenic
982983763 4:162177489-162177511 TTGGAGTAGAAAAGAAAGTGTGG - Intergenic
983884111 4:172961721-172961743 CTGGAGAAGAGAATAAAGAGAGG + Intronic
983993149 4:174147177-174147199 GTGGAGAAATGAAGAAACAGAGG - Intergenic
990557910 5:56953056-56953078 TTGGAGAAGTGAGGGAAGTGAGG - Intronic
991322733 5:65393437-65393459 TTGGAGAAATGATGAGAGCTAGG - Intronic
991392526 5:66162454-66162476 TTGGAGAAGTGAAGTTTGTGCGG + Exonic
992132444 5:73706823-73706845 AGGGAGGAGAGAAGAAAGCGGGG - Intronic
992376712 5:76195033-76195055 TTGGACAAATGAAGAAAGGAAGG - Exonic
993479201 5:88401894-88401916 TTGGAAAAGGGAAGAAAGAAAGG - Intergenic
994126335 5:96171767-96171789 TTGGAGAAGAGAATAAAAAGAGG + Intergenic
994431259 5:99664428-99664450 TAAGAGAAGTGAGGAAAGTGCGG - Intergenic
994795866 5:104299059-104299081 TAGGAGAAGTGAAGAACAGGGGG - Intergenic
996337083 5:122396137-122396159 CTGGAGAAGGGAAGAATGAGAGG - Intronic
996477725 5:123940238-123940260 GTGGAGAATTGATGAAAGAGAGG + Intergenic
996575259 5:124971648-124971670 TTGGAGAAGAGAGTAAAGAGAGG + Intergenic
997039074 5:130230350-130230372 TTAGAGAAGTAAAGAAAGATGGG + Intergenic
998171461 5:139874262-139874284 TTGGAGAAGTGAAGGTGACGTGG + Intronic
999792382 5:154953556-154953578 TTGGGGGAGTGAAGAAAAAGAGG - Intronic
1001716633 5:173821714-173821736 TTGGAACAGTGAAGAAAGTGGGG + Intergenic
1001934614 5:175695293-175695315 TTTGACAAGTGAAGAAACCGAGG - Intergenic
1003766529 6:9243314-9243336 TGGGATGAGTGAAGAAAGCTTGG + Intergenic
1004105743 6:12666100-12666122 TTGGAGAGGAGAAGAAAACAGGG + Intergenic
1004359134 6:14955364-14955386 TTAGAGAAGTGGAGAGAGCAGGG + Intergenic
1004768881 6:18759301-18759323 TTGGAGAAGAGAGGAAAAAGAGG + Intergenic
1004802739 6:19168696-19168718 TTAGAGAAGTGTAGGAAGTGTGG + Intergenic
1005721069 6:28602550-28602572 TTGGGGCAGAGAAGAAAGAGAGG - Intronic
1005960618 6:30690514-30690536 TTGGAGAACCGAAGTAAGAGGGG - Intronic
1006148119 6:31971305-31971327 TTGGAGGGGTGAGCAAAGCGTGG - Exonic
1007416503 6:41694309-41694331 TTGGAGAAGTGGACACAGTGAGG + Intronic
1008346244 6:50430595-50430617 TTGGAGAAATGAAAATAGCTAGG - Intergenic
1008515350 6:52313788-52313810 TTGAAGAACTGAAAGAAGCGAGG - Intergenic
1008654813 6:53601208-53601230 TGGGAGAAGGGGAGAAAGCAGGG + Intronic
1009269573 6:61600788-61600810 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1009403312 6:63281788-63281810 TTGTAAAAGTGAATAAAGAGAGG - Intronic
1009791783 6:68411412-68411434 TTGGAAAAATGAAGAAAAGGAGG - Intergenic
1010174847 6:73016363-73016385 TGGGAGAAGTGGAGAAAATGAGG + Intronic
1012278203 6:97298605-97298627 ATGGAGTAGTGAATAAAACGAGG + Intergenic
1012506947 6:99958221-99958243 TTAGAGAAGTGAGGAAAGAATGG + Intronic
1013979094 6:116108849-116108871 TTGGATAAATGAAGAAAGAGAGG - Intronic
1015926328 6:138313324-138313346 TTGGAGAAATGAAGGAGGCTGGG - Intronic
1016231025 6:141804094-141804116 TTGGAAAGGGGAAGAAAGTGTGG - Intergenic
1016353705 6:143195118-143195140 GTGGAGAAGTGAAGAACTCTGGG + Intronic
1016492824 6:144626457-144626479 TTGGAGAAATGCAGAAAGGCGGG - Intronic
1016793710 6:148095002-148095024 TTGGAAAGGTGGAGAAAGAGTGG + Intergenic
1016979801 6:149843754-149843776 GTGGAGATGGGAAGGAAGCGGGG - Intronic
1018219253 6:161562146-161562168 TTGGGGAAGCCAAGAAGGCGGGG - Intronic
1018363317 6:163094922-163094944 TTGGAGAAGTGAATACCGAGGGG - Intronic
1019041675 6:169111042-169111064 CTGGAGAAGGGAAGAAAGATGGG - Intergenic
1021452149 7:20792993-20793015 TTTGAGAACTCAAGAAAGCATGG - Intergenic
1021810378 7:24396854-24396876 TTGGAGAAGAGAGGAAAAAGAGG - Intergenic
1022350272 7:29561493-29561515 TTGGAGGTGTGAAGAAATTGAGG - Intergenic
1022708833 7:32833173-32833195 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1022710306 7:32842922-32842944 TTGGAGAAGAGAGTAAAGAGAGG + Intergenic
1022979386 7:35589918-35589940 TTGGAGGAGTCAAGACAGAGGGG - Intergenic
1023733922 7:43218483-43218505 GTGGAGAAGGGAAGGAAGCAAGG + Intronic
1026370889 7:69697884-69697906 TTGAAGAAGTGAAGGAAAAGCGG - Intronic
1027157532 7:75779464-75779486 TTGGAGAAGAGAGTAAAGAGAGG - Intronic
1027219394 7:76204317-76204339 GTGTAGGAGTGAAGAAAGAGGGG - Intronic
1027621523 7:80493190-80493212 ATGGAGAAATGAAAAAAGAGAGG + Intronic
1027804997 7:82807599-82807621 TTGAAAAAGTGAAGAAATGGGGG - Intronic
1028938627 7:96493751-96493773 TTGGAGTAGAGAAGAAGGCAAGG - Intronic
1029316870 7:99723721-99723743 TTGGAGAAGAGAATAAAAAGAGG - Intronic
1029570219 7:101363697-101363719 TTGGGGAAGCGAAGAAAGGAAGG - Intronic
1031070356 7:117154897-117154919 TTGGAGAAGGGAGGAAGGGGAGG + Intronic
1032435430 7:131897001-131897023 TTGGAGAAGTAAAGAAACAAAGG + Intergenic
1032565137 7:132933983-132934005 TTGCAGAAGTGAATAAAGCTGGG + Intronic
1033237101 7:139646780-139646802 GTGGAGAAGGGAAGAAAGGAAGG + Intronic
1034205402 7:149310259-149310281 TTCTAGAAGTGAAGAAAACTAGG - Intergenic
1034454835 7:151163099-151163121 GTGGAGAAATGTAGAAAGCTGGG - Intronic
1036064493 8:5363642-5363664 CTGGGGAAGTGAAGACAGCTGGG + Intergenic
1036140361 8:6201904-6201926 ATGGAGAAGGTAAGAAAGTGGGG + Intergenic
1036621324 8:10425932-10425954 TTGGAGAAGAGAAAAAGGCACGG - Intronic
1037503630 8:19508974-19508996 TTGGAGAAAAGAAGAAAAAGTGG + Intronic
1039499206 8:38003527-38003549 TTGGAGAAGAGAATAAAAAGAGG + Intergenic
1039607897 8:38898153-38898175 TGGGAGAAGAGAAGAATGGGAGG + Intergenic
1040853834 8:51928527-51928549 TTGCAGAGGTGAAGGAAGCATGG + Intergenic
1041699040 8:60767314-60767336 TTGAAGAAGTGAAGAAGGTGAGG + Intronic
1042107379 8:65342927-65342949 GTGGAGAAGAGAAGACAGAGTGG + Intergenic
1042705859 8:71665183-71665205 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1043889002 8:85635490-85635512 TTGGAGTAGTCCAGAAAGCCTGG - Intergenic
1044455499 8:92388363-92388385 TTGCAGAAGAGAACAAAGAGAGG - Intergenic
1044817062 8:96124188-96124210 TTGGAGAAAGGAATAAAGGGGGG + Intergenic
1045590782 8:103593950-103593972 TTGGAGAACTGATGAAATAGAGG + Intronic
1045908532 8:107377573-107377595 TTGGAGAAGTGGAAGAAGAGAGG + Intronic
1046448460 8:114356944-114356966 GAGGAGAAGAGAAGAAAGAGTGG + Intergenic
1047012989 8:120692463-120692485 TAAGAGAAATAAAGAAAGCGAGG - Intronic
1047029409 8:120860999-120861021 TTGGAGAAGGGAACAAATGGAGG - Intergenic
1047672191 8:127160333-127160355 TTGTATAAGTGAAGAAACTGAGG + Intergenic
1049947986 9:616434-616456 TTGGAGAAGTGACAAAATAGAGG - Intronic
1050140259 9:2510267-2510289 TTGGAGAAGAGAATAAAACGAGG - Intergenic
1050277343 9:4013678-4013700 CTGGAAAAGTGAAGAAAAGGTGG - Intronic
1050494967 9:6230928-6230950 TTTTAGAAGTGAAGAAATAGTGG - Intronic
1050585867 9:7110729-7110751 TTGAAGAAGGGATGAAAGTGGGG + Intergenic
1050627644 9:7522145-7522167 TTGGGGAAGTGAAGAATTGGAGG + Intergenic
1052613463 9:30807364-30807386 ATGGAGAAGTGAAAAGATCGAGG + Intergenic
1053596191 9:39563942-39563964 CTGGAGAAGTGAAGCTAGGGAGG + Intergenic
1053684842 9:40511518-40511540 TAGGGAAAGTGAAGAAAGTGGGG - Intergenic
1053854159 9:42320583-42320605 CTGGAGAAGTGAAGCTAGGGAGG + Intergenic
1054278885 9:63113438-63113460 TAGGGAAAGTGAAGAAAGTGGGG + Intergenic
1054297934 9:63346981-63347003 TAGGGAAAGTGAAGAAAGTGGGG - Intergenic
1054395951 9:64651499-64651521 TAGGGAAAGTGAAGAAAGTGGGG - Intergenic
1054430595 9:65156694-65156716 TAGGGAAAGTGAAGAAAGTGGGG - Intergenic
1054499785 9:65864827-65864849 TAGGGAAAGTGAAGAAAGTGGGG + Intergenic
1054570065 9:66801075-66801097 CTGGAGAAGTGAAGCTAGGGAGG - Intergenic
1055420527 9:76136331-76136353 TTGGGGAAGTGGAGAATGCAGGG + Intronic
1055523450 9:77106034-77106056 TGGAAGAAGTGAAGGAAGAGGGG + Intergenic
1056053399 9:82794347-82794369 ATGAAGAAGTGGAGATAGCGGGG - Intergenic
1057345968 9:94251026-94251048 TAGGAGGACTGAACAAAGCGGGG - Intergenic
1057495319 9:95555706-95555728 CTGGAGAAGTGAAGGAAGCAGGG - Intergenic
1058428145 9:104894014-104894036 TTTTAGAAGTGAAGAAACTGAGG + Intronic
1058624686 9:106922755-106922777 TTGGAGAAGGGAGGAAAGAGAGG + Intronic
1058883440 9:109305179-109305201 TGGGAGAAGTGGAAGAAGCGCGG + Intronic
1059734351 9:117086694-117086716 CGGGAGAAGTGAAGACAGGGTGG - Intronic
1060482947 9:124028528-124028550 TTGTACAAGTGAAGAAACTGAGG + Intronic
1061582805 9:131547777-131547799 TTGGAGAAGAGAGTAAAGAGAGG - Intergenic
1188333259 X:28897529-28897551 TTGGAGAAGAGAATAAAAAGAGG + Intronic
1188533032 X:31163513-31163535 TTGGAGTGGAGAGGAAAGCGTGG - Intronic
1189324263 X:40103482-40103504 GGGGAGAAGTTCAGAAAGCGAGG + Intronic
1189450672 X:41126168-41126190 TTAGAGAAGTGAACAAGTCGGGG + Intronic
1189865791 X:45325788-45325810 ATTGAGAAGAGAAGAAAGCAAGG + Intergenic
1190469981 X:50769186-50769208 ATGAAGGAGTGAAGAAAGGGAGG + Intronic
1191682905 X:63859446-63859468 CTGGAGATGGGAAGAAAGTGGGG - Intergenic
1192183824 X:68932528-68932550 TTGGACAGCTGAAGAAAGGGAGG - Intergenic
1192313569 X:70035310-70035332 TTGGGGAAGAGAGGAAAGAGAGG - Intronic
1192545523 X:72009516-72009538 GTGGAGATGTGAAGGAAGTGAGG - Intergenic
1193016348 X:76738318-76738340 GAGGAGAAGAGAAGAAAGAGTGG + Intergenic
1193815788 X:86102925-86102947 TTGGAAAGGGGAAGAAAGAGTGG + Intergenic
1195263867 X:103161077-103161099 TTGGAGAAGAGAAGAGAGGGGGG + Intergenic
1195327107 X:103766753-103766775 TTGGAGAAGAGAGTAAAGAGAGG + Intergenic
1195852102 X:109294822-109294844 TTGGAGAGGGGAAGGAAGAGTGG - Intergenic
1195952516 X:110290833-110290855 TTGTAGTATTGAAGAAAACGGGG - Intronic
1196789167 X:119448604-119448626 TTGGAGATCTGAAGGAAGTGAGG - Intronic
1197112044 X:122787845-122787867 TTTCACAAGTGAAGAAAGTGAGG + Intergenic
1197429492 X:126342805-126342827 TTGGAAAGGGGAAGAAAGAGTGG + Intergenic
1197932796 X:131712603-131712625 TTGGAGAAGTGAGTAAAAAGAGG - Intergenic
1198425473 X:136515600-136515622 ATGGGGCAGTGAAGAAAACGTGG + Intergenic
1200477040 Y:3650374-3650396 TCGGAGAAGGGAAGAAAGAAAGG - Intergenic