ID: 966300715

View in Genome Browser
Species Human (GRCh38)
Location 3:178476678-178476700
Sequence CAAGCTACTCCCCTTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966300713_966300715 -3 Left 966300713 3:178476658-178476680 CCACGCTTTCTTCACTTCTCCAA 0: 1
1: 0
2: 0
3: 30
4: 362
Right 966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG 0: 1
1: 0
2: 1
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966300715 Original CRISPR CAAGCTACTCCCCTTGAAAT AGG Intronic
906669346 1:47643327-47643349 CAAGCCTCTCCCCTTGGTATAGG - Intergenic
910675728 1:89814805-89814827 CATGCAACTCACATTGAAATAGG - Intronic
911498385 1:98657928-98657950 CAAGCAGCTCCTCATGAAATGGG + Intergenic
913482733 1:119304375-119304397 CACGATAATCCCCTTGAGATAGG + Intergenic
915615121 1:157031692-157031714 TTTGCCACTCCCCTTGAAATTGG - Intronic
920163338 1:204016907-204016929 CAAGCCTCTTCCCTTGAAACTGG - Intergenic
920386382 1:205572636-205572658 CCAGCTTCTCCCCTTGAGCTGGG + Intronic
922248086 1:223819847-223819869 CAAGGCACTCCCCTTGAGCTGGG + Intronic
924221607 1:241881469-241881491 AATGCTACTCCACTTGAAAGTGG + Intronic
924380304 1:243456980-243457002 CAATCTGCTCCCCTAGAATTTGG - Intronic
1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1068252281 10:54457904-54457926 CAAACTTCTCCACTTGAAACAGG - Intronic
1072990889 10:100192182-100192204 CAAGCAACTACACTTCAAATTGG + Intronic
1073097286 10:100987547-100987569 CATGCTACTCGCCTTGACCTCGG - Intronic
1080896661 11:36453880-36453902 CAAGCTCCTCCCCTTGGCCTGGG - Intronic
1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG + Intronic
1086935660 11:92743230-92743252 CAAGGTGCTCCCCTTAAAAGAGG - Intronic
1089611367 11:119671341-119671363 CAAGCTGCTCCCTTTGTAAGAGG - Intronic
1093970028 12:25367845-25367867 CAAGCAACTCACATTAAAATGGG - Intergenic
1094126699 12:27031212-27031234 AAGGATACTCCCATTGAAATTGG - Intronic
1100248112 12:92784863-92784885 CCATCTACTCCCCTTGAAATAGG + Intronic
1104638517 12:130452560-130452582 CAGGCTACTCCCCTTCCAACTGG + Intronic
1106034788 13:26033764-26033786 CAAGCCCCTCCCCTTGAACCTGG - Intergenic
1108470096 13:50758899-50758921 CAATCTTCTCCCCTTGAATGTGG - Intronic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1116752054 14:48899087-48899109 CAAGCAACTCTCCTGGGAATGGG + Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1125313539 15:38406692-38406714 CAAGCTACCCCACGTGAAGTGGG + Intergenic
1126943679 15:53793406-53793428 CAGTGTACTCCCCTTCAAATTGG - Intergenic
1131410135 15:92200697-92200719 CACTCTACTTCCCTTTAAATTGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1135428745 16:22363684-22363706 TAAGCTCCTCCCCCTTAAATTGG - Intronic
1141051992 16:80775441-80775463 CAACCCACCCCCCTTGAAAAAGG - Intronic
1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG + Intergenic
1145318255 17:21747879-21747901 CAATCTCCTCCCTGTGAAATGGG - Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155858482 18:30866137-30866159 TGAGCTACTCTCCTAGAAATAGG - Intergenic
1156600644 18:38601837-38601859 CAAGCTATTTCCCATAAAATGGG - Intergenic
1159319428 18:66827911-66827933 AATTCTACTCCCCTTGAAAATGG - Intergenic
1165338095 19:35187336-35187358 CAAGATAATCCCCTTGAACCTGG + Intergenic
1166840202 19:45692628-45692650 CAAGTTCCTCCCCATGGAATCGG - Exonic
928221606 2:29407923-29407945 AAAGCTACTCTCCTAGTAATTGG - Intronic
930305852 2:49673563-49673585 CAATCTTCTCCCCTTGAATTCGG - Intergenic
936956668 2:118029299-118029321 CAAGCGCCTCCCCTTGACTTGGG - Intergenic
937289594 2:120774050-120774072 CCTGCTCCTCACCTTGAAATTGG - Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
940301964 2:152184801-152184823 CAAACTACTGCCCTCAAAATTGG - Intergenic
942243923 2:173990096-173990118 CAAGCTACTCACCTTTAGGTCGG + Intergenic
948749201 2:240120526-240120548 CAAACATCTCCCCTTCAAATTGG - Intergenic
1171333389 20:24360994-24361016 CAACCTATTCCCCTTGAAGCTGG + Intergenic
1173069147 20:39744684-39744706 CAAGCTACACACCCTGAAGTGGG + Intergenic
1174394561 20:50238873-50238895 CAAGCCACTACCCATCAAATGGG - Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1177607313 21:23398274-23398296 CAAGCTTCTCCTCCTGAAAATGG + Intergenic
1178231315 21:30788095-30788117 CACCCTACTCCCCATAAAATTGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1182085989 22:27561545-27561567 CAAGAGACTGCCATTGAAATTGG + Intergenic
1182279287 22:29208720-29208742 CAAGGTCTTCCCCTTGGAATAGG - Intronic
953933245 3:47017619-47017641 CAAGGTACTCCCCTTGCTTTTGG - Exonic
963684949 3:148421605-148421627 CAAGAAACTCCCCCTTAAATTGG - Intergenic
964420013 3:156492311-156492333 CAAGCCCCTCCCCTTGAATCTGG + Intronic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
969648371 4:8447576-8447598 CTGTCTACTCACCTTGAAATGGG + Intronic
973268806 4:48238840-48238862 CAAGCTACTTCCCTGGATTTAGG + Intronic
974189543 4:58486796-58486818 CAAACTACTGCCCTCAAAATTGG - Intergenic
978656424 4:111070535-111070557 CAAGCTGTTCTCCTGGAAATGGG - Intergenic
980623668 4:135344332-135344354 CTACCTACACCCCTTGGAATAGG + Intergenic
980855206 4:138431575-138431597 CTATCTACTCCCCTGGAAAGGGG + Intergenic
989286467 5:39705689-39705711 CAAGATAGTCATCTTGAAATCGG + Intergenic
991726885 5:69544669-69544691 ATGGCTACTCCCCTTTAAATTGG + Intronic
991868072 5:71083205-71083227 ATGGCTACTCCCCTTTAAATTGG - Intergenic
996985412 5:129556578-129556600 CAATCAACTGACCTTGAAATAGG + Intronic
999533525 5:152489411-152489433 CAACCTTCTCCCCTTGAATGGGG - Intergenic
1002831664 6:827288-827310 CACGCTTCTCCCCTTGAATCAGG - Intergenic
1003670185 6:8150008-8150030 CAACCTTCTCACTTTGAAATGGG + Intergenic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1012998569 6:105997636-105997658 CAACCTACTTCCCTTAAAAAAGG - Intergenic
1017787184 6:157766206-157766228 CAAGTTCATCCCTTTGAAATGGG - Intronic
1019919952 7:4157223-4157245 CCAGCTACTCCACATGCAATGGG - Intronic
1022301821 7:29108975-29108997 CAAGTTACTCAACTAGAAATTGG - Intronic
1024151999 7:46581425-46581447 TAAGCTGCTCCCCTGGGAATGGG - Intergenic
1028720717 7:94027794-94027816 CAATCAACTCACCTTAAAATAGG + Intergenic
1031034050 7:116767556-116767578 AAAGATACTCCCCCTGAAGTAGG - Intronic
1032209762 7:129902630-129902652 CAAGCTCCTCCACCTTAAATAGG - Intronic
1035007804 7:155681731-155681753 AAAGCTACTCCCATTGCAAATGG - Intronic
1037770994 8:21799746-21799768 CAAGCTAATCCCCCTGAAGTGGG + Intronic
1038535141 8:28348397-28348419 CAAGCTAATCCCCTAGAGAGTGG + Exonic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040972085 8:53146319-53146341 CAAGCTACTTCACCTGAAATTGG + Intergenic
1043302375 8:78749920-78749942 CCAGCTACTCAGGTTGAAATAGG + Intronic
1044751142 8:95416738-95416760 TCAGCTACTCACCTTCAAATAGG - Intergenic
1045360955 8:101432782-101432804 CAGGTTACTCCACTTAAAATAGG + Intergenic
1046854491 8:119015732-119015754 CAAACTACTGCCCCTGAAATTGG - Intronic
1047583577 8:126243905-126243927 CAGGCTACTCTCCTTGAACGAGG + Intergenic
1050153578 9:2642210-2642232 CAAGCTACTGCCCTTTTTATAGG + Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186363973 X:8872588-8872610 CATGCTACTGGCCTTGAAAATGG + Intergenic
1194355172 X:92874210-92874232 CAAGCTACTTTCCGTGAAAAAGG - Intergenic
1199546967 X:149016758-149016780 CATGCCACTCCCTTTAAAATGGG + Intergenic
1200046450 X:153405351-153405373 CCAGCTACACCTCTTGAAAGGGG - Intergenic
1200663530 Y:5991232-5991254 CAAGCTACTTTCCGTGAAAAAGG - Intergenic