ID: 966305131

View in Genome Browser
Species Human (GRCh38)
Location 3:178523165-178523187
Sequence CAGCATGAGCACAAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 9, 3: 57, 4: 535}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966305124_966305131 29 Left 966305124 3:178523113-178523135 CCCAGATGAAAAAGAGAGGAGAA 0: 1
1: 2
2: 6
3: 69
4: 669
Right 966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG 0: 1
1: 0
2: 9
3: 57
4: 535
966305123_966305131 30 Left 966305123 3:178523112-178523134 CCCCAGATGAAAAAGAGAGGAGA 0: 1
1: 1
2: 3
3: 41
4: 438
Right 966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG 0: 1
1: 0
2: 9
3: 57
4: 535
966305125_966305131 28 Left 966305125 3:178523114-178523136 CCAGATGAAAAAGAGAGGAGAAG 0: 1
1: 1
2: 1
3: 45
4: 473
Right 966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG 0: 1
1: 0
2: 9
3: 57
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966305131 Original CRISPR CAGCATGAGCACAAGCAGAG AGG Intronic
900037084 1:423261-423283 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900058714 1:659002-659024 CAGCATGAGCAAATGCAAGGAGG + Intergenic
900809086 1:4787581-4787603 CAGCAAGAGTGGAAGCAGAGGGG + Exonic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
902302277 1:15510682-15510704 CGGCATGAGCAAAGGCAGGGAGG + Intronic
902582445 1:17416672-17416694 CAGCAGCAGCACAAGCACAAGGG + Intronic
903005999 1:20299275-20299297 CAGCTGGAGCCCAAGAAGAGGGG + Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903287326 1:22285347-22285369 CCGCGGGAGCACAAGGAGAGAGG - Intergenic
903789099 1:25880657-25880679 CAGCAGGAGCACAAGGTGATGGG + Intergenic
904490897 1:30858433-30858455 CAGCATGGGCAAAGGTAGAGAGG - Intergenic
904584433 1:31572102-31572124 CAGCATGAGCAAAAGCCCTGAGG - Intergenic
904814186 1:33182739-33182761 CAGCCTGTGCAAAAGCATAGAGG + Intergenic
904851244 1:33461331-33461353 CATCATGAGAATAGGCAGAGAGG - Intergenic
905490646 1:38340872-38340894 CAGAATGAGCACCAGGAAAGAGG + Intergenic
905575733 1:39043177-39043199 CAGTATGAGCAAAAGCATGGAGG + Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
906278169 1:44533821-44533843 CAGAATGAGCAAAAGCAGAGAGG + Intronic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
907074413 1:51565367-51565389 CAGCAGGAGCAAAGGCACAGTGG - Intergenic
907310262 1:53535016-53535038 AAGCATGAACAAAAGCAGGGAGG + Intronic
907386297 1:54127725-54127747 CAGCATGTGCAAATGCAAAGAGG - Intergenic
907519480 1:55013867-55013889 CAGCATGAGCCAAGGCAGGGTGG - Intergenic
907561779 1:55397608-55397630 CATCATGAGAAAAAGCATAGAGG - Intergenic
908313296 1:62907242-62907264 CTCCATAAGCACAAGGAGAGGGG + Intergenic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908680572 1:66656484-66656506 CAGCATCACCACAAGCACATGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909384159 1:75036509-75036531 GAGGGTGAGCACAAGCAGGGTGG + Intergenic
909658202 1:78054094-78054116 CAGCATGAGAAAAAGCACAATGG - Intronic
910253301 1:85220794-85220816 CAGCATGAACAAAGGCAGAGAGG + Intergenic
910329638 1:86056279-86056301 CAGCATGAGCTCATGAAAAGAGG + Intronic
911136753 1:94448863-94448885 CAGCAGTTGCAAAAGCAGAGGGG + Intronic
911248482 1:95547543-95547565 CGGCAAGTGCACAAGCAAAGAGG - Intergenic
911285466 1:95986713-95986735 CAACATGAGCAAAGGCACAGGGG + Intergenic
915512912 1:156396376-156396398 CAGCATGTGCAAAAGCTCAGTGG + Intergenic
915730597 1:158051226-158051248 CAGCATAAGCACAGGCACAAAGG - Intronic
915891010 1:159774021-159774043 CAGCATGGGCACAGGCACATAGG + Intergenic
916488653 1:165281584-165281606 CAGGCTGACCACAGGCAGAGAGG + Intronic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919519802 1:198573526-198573548 CAGCATGTGCAAAATCACAGAGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920593425 1:207244704-207244726 CAGCATTACCACTAGCTGAGTGG - Intergenic
920593491 1:207245399-207245421 CAGAATCAGTACAAGCAAAGAGG - Intergenic
921067675 1:211634099-211634121 CAGCAAGACCACAGGCAGTGTGG + Intergenic
921257263 1:213353917-213353939 CAGCCTGAGCAAAGGCACAGAGG + Intergenic
921650217 1:217669959-217669981 CTCCAGGAGAACAAGCAGAGAGG - Intronic
922050348 1:221983426-221983448 CAGCATGAGCAAAGGCATGGAGG - Intergenic
922292378 1:224219102-224219124 CATCATGAGCACAAACTCAGAGG + Intergenic
923898851 1:238303784-238303806 CAGCATGAGGCCAGGCACAGTGG + Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
1064102136 10:12472988-12473010 CAGGATGAGCAGAAACACAGAGG + Intronic
1064288504 10:14013043-14013065 CACCATGAGCCCCAGCAGAAGGG + Intronic
1065721752 10:28634440-28634462 AGGCAGGAGCACAAGCATAGTGG + Intergenic
1067071008 10:43132054-43132076 CAGCAGGAGCCCTGGCAGAGAGG - Intergenic
1067461980 10:46465077-46465099 CAGCATGTGCAAAGGCACAGAGG + Intronic
1067625215 10:47919521-47919543 CAGCATGTGCAAAGGCACAGAGG - Intergenic
1067663296 10:48252468-48252490 CAGCCAGAGCTCAAGCAGGGCGG + Intronic
1068903061 10:62291624-62291646 CACCATGAGCAAAATCAGATGGG + Intergenic
1069294801 10:66830505-66830527 GAGCACGAGTAGAAGCAGAGTGG - Intronic
1069461590 10:68599920-68599942 CAGGATGAGGACAAAAAGAGAGG - Intronic
1069806438 10:71128020-71128042 CAGCATCAGCACAGGATGAGGGG - Intergenic
1069812078 10:71169082-71169104 CTGCATGTGAACAAGCAGACAGG + Intergenic
1070418074 10:76208738-76208760 CTGGATAGGCACAAGCAGAGGGG - Intronic
1070533665 10:77359455-77359477 CAGCCTCAGCCCAACCAGAGCGG + Intronic
1071807365 10:89138447-89138469 CAGCCTGAGCACAAGCACAGAGG + Intergenic
1072287247 10:93927842-93927864 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073534685 10:104266293-104266315 CTGAATGAGAACAAGCAGACAGG + Intronic
1073817324 10:107222401-107222423 CAGCATGATTAAAGGCAGAGAGG - Intergenic
1074485369 10:113871969-113871991 CTCCATGAGAACAAGCAGAGTGG + Intronic
1074769273 10:116722989-116723011 CAGCAAGGGCAAAAGCAGAGCGG + Intronic
1074809728 10:117091690-117091712 CAGCATGAGCAAATGCATACTGG - Intronic
1075122326 10:119673087-119673109 CAGCATGGGCAAAGGCACAGGGG - Intronic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1076496292 10:130899821-130899843 CAGCATTGGCAAGAGCAGAGAGG + Intergenic
1076963810 11:61183-61205 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077414599 11:2418891-2418913 CAGCATGAGCGCGTGCAGTGTGG - Intronic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1077582529 11:3425757-3425779 CAGCATTAGGACAATCTGAGTGG + Intergenic
1077729192 11:4710377-4710399 GAGCATGTGCACAAGGGGAGGGG - Intronic
1077995314 11:7447449-7447471 CAGCATGAGCAAAAGCAAAGTGG - Intronic
1078162945 11:8857634-8857656 CAGCATGAGCAAAGGCCCAGAGG - Intronic
1079163995 11:18020447-18020469 TAGCATGAGCAAAAGTATAGAGG - Exonic
1079769602 11:24443313-24443335 TATCATGAGCACAAGCAAGGGGG - Intergenic
1080031417 11:27665443-27665465 GAGCATGAGCCAAAGCAGGGTGG + Intronic
1080693553 11:34580835-34580857 CAGCATGAGCAAAGGCTCAGGGG + Intergenic
1081340535 11:41921992-41922014 CAGGAAGAGCACAAACAAAGAGG - Intergenic
1081488717 11:43550416-43550438 CTGCATGAGCAAAGGCAGAGAGG + Intergenic
1081934377 11:46894939-46894961 CAGCATCAGTACCAGAAGAGTGG + Intronic
1082654014 11:55830270-55830292 CAGCATAAGGACTAGGAGAGTGG + Intergenic
1083277578 11:61605896-61605918 CAGCTTAAGCAAAAGCACAGAGG - Intergenic
1084020282 11:66413296-66413318 CAGCATGTGCAAAAGCACTGTGG + Intergenic
1084239438 11:67808581-67808603 CAGCATTAGGACAATCTGAGTGG + Intergenic
1084832993 11:71784268-71784290 CAGCATTAGGACAATCTGAGTGG - Intergenic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085352842 11:75811280-75811302 CAGCATGAGCAAAGGCACAGGGG - Intergenic
1085383851 11:76144650-76144672 CAGCATGGGCACAGGCCCAGAGG + Intergenic
1085514608 11:77105070-77105092 CAGGAAGAGCTCAAGCAGAAGGG - Intronic
1085717148 11:78882358-78882380 CAGCATGGGCAAAAGCATGGTGG - Intronic
1087129992 11:94660489-94660511 CCACATGACCACAAGCACAGAGG - Intergenic
1087235358 11:95712068-95712090 CAGAATGAGCCCAAGCAAAATGG + Intergenic
1088704230 11:112447575-112447597 CAGGAAGAGCAGTAGCAGAGTGG - Intergenic
1088789242 11:113209936-113209958 CAGCCTGGGCACAGGCACAGAGG + Intronic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090534081 11:127621317-127621339 CAGTATGAGAGAAAGCAGAGAGG - Intergenic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091908756 12:4211774-4211796 CTGCCTGGGCCCAAGCAGAGGGG + Intergenic
1091960596 12:4690929-4690951 CAGCATGAGCAATTGCAGTGGGG + Exonic
1092410121 12:8246203-8246225 CAGCATTAGGACAATCTGAGTGG + Intergenic
1092724112 12:11468092-11468114 CAGCATGTGCAAAGGCACAGTGG - Intronic
1093351646 12:18109673-18109695 TAGCAAGAGAAAAAGCAGAGGGG + Intronic
1094306955 12:29031088-29031110 CAGAATGAACAAAAGCATAGAGG + Intergenic
1094424159 12:30301509-30301531 CAGCATGAGCCCAGGCCCAGAGG + Intergenic
1094687969 12:32737912-32737934 CAGCCTCAGCAGAAGCAGCGGGG - Exonic
1094752069 12:33421884-33421906 CAGCATGAACAAAAGCACAGAGG + Intronic
1095040558 12:37435831-37435853 CAGCATGTGCCCTAGAAGAGAGG - Intergenic
1096044944 12:48554166-48554188 GAGCATGAGCCAAAGCAGGGTGG - Intergenic
1096283296 12:50275702-50275724 CTGCATGAGCAAAGGCACAGAGG + Intronic
1096465547 12:51846392-51846414 CAGCGGGAGCAAAGGCAGAGAGG + Intergenic
1096631343 12:52928566-52928588 GAGCATGACTACAAGTAGAGGGG - Intronic
1097829409 12:64207881-64207903 CAACAGGAGCCTAAGCAGAGAGG + Intronic
1098062195 12:66574733-66574755 CTGCAAGAGGACAAGTAGAGTGG - Intronic
1098579103 12:72077853-72077875 CAGAATGAGCACTAGCAGGAAGG - Intronic
1098638553 12:72813533-72813555 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
1099260955 12:80382309-80382331 CTGCATGAGCAGAAGTGGAGTGG - Intergenic
1099806853 12:87531128-87531150 GAGCATGAGCCAAAGCAGGGTGG + Intergenic
1099965483 12:89440795-89440817 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100487556 12:95044910-95044932 GAGGCTGAGCACAAGCACAGTGG + Intronic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1101529398 12:105560322-105560344 CAGCATGAGCAAAAGCTCAGAGG - Intergenic
1102204724 12:111082743-111082765 GAGCATGAGCAAAAGCTCAGAGG + Intronic
1102624471 12:114223982-114224004 CAACGTAAGCAAAAGCAGAGAGG + Intergenic
1102821838 12:115915118-115915140 CAGCCTGAGCAAAGGCAGACAGG + Intergenic
1103203662 12:119110790-119110812 GAGCATGAGCCAAAGCAGGGCGG - Intronic
1103256204 12:119543578-119543600 CAGCATGTGCAAAGGCCGAGAGG + Intergenic
1103303244 12:119944109-119944131 TTTCATGAGCACAAGCTGAGGGG - Intergenic
1103329254 12:120142543-120142565 CAGCAGGAGCCCAAAGAGAGTGG + Exonic
1103696621 12:122820901-122820923 CAGCATGAGTAAAAGCACAGAGG + Intronic
1104310454 12:127650126-127650148 CAGAATCAGCACATTCAGAGAGG - Intergenic
1106038720 13:26069414-26069436 CAGCAGGATCAGAATCAGAGAGG - Intergenic
1106355291 13:28976284-28976306 CAGCATGAGTTGAGGCAGAGAGG + Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106580892 13:31017310-31017332 CAGCATGTGCAAAAGCACAGAGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107764586 13:43720682-43720704 GAGCATGGGCACGAGCAGAGGGG + Intronic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1107965966 13:45598573-45598595 CAGCATGAGTCCAAGATGAGAGG + Intronic
1108156910 13:47594635-47594657 AAGCATGAACAAAAGCATAGAGG - Intergenic
1108379016 13:49839294-49839316 CAGCTTGAGCAAAGGCTGAGAGG - Intergenic
1110000259 13:70188725-70188747 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1110552144 13:76821987-76822009 AAGCAAGAGCAGGAGCAGAGAGG - Intergenic
1110895697 13:80749586-80749608 CAGCATGAGCAGAACTAGAGTGG + Intergenic
1111627873 13:90813046-90813068 CAGGATGAGCAAAAGCAGGGTGG + Intergenic
1111645962 13:91032275-91032297 CAGCAAGGGGACAAGAAGAGTGG - Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112641230 13:101277873-101277895 CCACATGAGCAGAGGCAGAGAGG - Intronic
1113560001 13:111271209-111271231 CAGCAGGACCACAAGGACAGAGG - Intronic
1113866053 13:113525310-113525332 CAGCATCACCACAAGCATGGGGG - Intronic
1115058561 14:29162304-29162326 CAGCAGCAGCACCAGCAGAAGGG - Intergenic
1115839723 14:37455563-37455585 CAGCATGAGCAAAAGTATACTGG - Intronic
1116238252 14:42308984-42309006 CAGCAGTTGCAAAAGCAGAGGGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117082995 14:52170695-52170717 CAGCAGTTGCAAAAGCAGAGGGG + Intergenic
1117490750 14:56244592-56244614 GAGGATGAGCATTAGCAGAGTGG - Intronic
1118209778 14:63754538-63754560 CAGAACTATCACAAGCAGAGGGG + Intergenic
1118330196 14:64808938-64808960 CAGAATGAGTCCAAGCAGACAGG + Intronic
1118729033 14:68653857-68653879 CAGCATGTGCAAAGGCACAGGGG + Intronic
1119435683 14:74596478-74596500 CAGCATGTGCACCAGCCTAGAGG + Intronic
1119437816 14:74609645-74609667 CAGCATGTGGGGAAGCAGAGGGG - Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120890399 14:89485817-89485839 CACCATGAGCCCAGGCAGTGAGG - Intronic
1121267006 14:92610713-92610735 CAGCATGAGCAGAGGCAAGGAGG + Intronic
1121602219 14:95213766-95213788 CAGGATGAGCAGAAGCAATGGGG - Intronic
1121678520 14:95773784-95773806 CAGCAAGAGCAAACGCAGGGAGG - Intergenic
1122119350 14:99543650-99543672 CAGCCTGAGCAAAGGCAGGGAGG + Intronic
1122350163 14:101084362-101084384 AAGGAAGAGCACATGCAGAGGGG + Intergenic
1122409950 14:101520798-101520820 GAGCAGGCGCACGAGCAGAGCGG + Intergenic
1122689712 14:103526386-103526408 GAGCAGGTGCACAAGGAGAGGGG + Intergenic
1122821175 14:104345958-104345980 CAGCAGGGGCACATGCAGTGGGG - Intergenic
1123219626 14:106843832-106843854 CAGCATGGCCACATCCAGAGGGG - Intergenic
1124140111 15:27069931-27069953 CAGCATGAGCAGAGACAGAATGG - Intronic
1125002702 15:34787648-34787670 CACCAGGAGTACAAGCACAGAGG - Intergenic
1125750255 15:42023036-42023058 CAGCATGAACACAGGCAGGGAGG + Intronic
1128918790 15:71592189-71592211 CACCATGGGAAGAAGCAGAGAGG + Intronic
1129330554 15:74824897-74824919 CAGCATGAGAAAAGGCAGGGAGG + Intronic
1129355221 15:74986356-74986378 CCGCATGAGCAAAAGCAAGGAGG + Intronic
1129679849 15:77652618-77652640 CAGCAGGAGCAACAGCTGAGAGG - Intronic
1129904944 15:79179905-79179927 GAGCATGAGCAAAAACACAGTGG - Intergenic
1130034456 15:80344451-80344473 CTGCTTGAGCACAAGCACTGTGG + Intergenic
1130535638 15:84783318-84783340 CAGCAGGAACACGAGCAAAGTGG + Exonic
1130878173 15:88032227-88032249 CAGCAGAAGGACAAGGAGAGGGG + Intronic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1131225844 15:90623888-90623910 CAGCATGCGCAAAAGCAGGGAGG - Intronic
1132444743 15:101903990-101904012 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1133608781 16:7413607-7413629 TAGCAAGAGGACAAGCAAAGGGG - Intronic
1133752709 16:8737011-8737033 CACCATGATGACAAGCACAGGGG - Intronic
1134144920 16:11753138-11753160 CACCATGAGGAAAAGCAGAAAGG + Intronic
1136686704 16:31999156-31999178 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136787316 16:32942693-32942715 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136882460 16:33911089-33911111 CAGCATGTGCAGAAACAGGGTGG - Intergenic
1137525079 16:49228245-49228267 GAGCATGAGCCGAAGCAGGGTGG + Intergenic
1138143659 16:54589332-54589354 CAGCATCAGCCTAAGCATAGTGG - Intergenic
1138346988 16:56326175-56326197 CAGGGTGTGCACCAGCAGAGTGG - Intronic
1139405263 16:66712829-66712851 CAGTATTAGCCCAAGCAGGGTGG - Intergenic
1140253158 16:73312573-73312595 ATGCATGAGCAAATGCAGAGGGG + Intergenic
1140344867 16:74203402-74203424 CACCATGGGAACAAACAGAGTGG + Intergenic
1140878519 16:79175895-79175917 CAGCATGACCAAAAGCTCAGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1203089550 16_KI270728v1_random:1204365-1204387 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1143301340 17:5912714-5912736 CAGCATGAGCGAAAACACAGAGG + Intronic
1143338218 17:6189446-6189468 CAGCATGTGCAGAATCAAAGAGG - Intergenic
1143632779 17:8148319-8148341 CAGCCTGGGCCCAGGCAGAGTGG - Intronic
1144665117 17:17097090-17097112 CAGGATCAGCCAAAGCAGAGGGG + Intronic
1144836821 17:18160925-18160947 GAGCAGGAGGACAAGCTGAGTGG - Intronic
1146651703 17:34611162-34611184 CAGCATGTGCAAAGGCACAGAGG + Intronic
1146718109 17:35103328-35103350 CAGGAGGAGGAGAAGCAGAGAGG + Intronic
1146938668 17:36828311-36828333 CAGCATAAGCAAAGGCACAGAGG + Intergenic
1147503973 17:40995695-40995717 AAGCATGAGACCAAGCTGAGCGG - Intergenic
1147588720 17:41667540-41667562 CAGCCTGAGCAAAGGCACAGGGG + Intergenic
1147917528 17:43897670-43897692 GAGCTTGAGCAGAAGCACAGAGG - Intronic
1149601968 17:57898990-57899012 CAGCAGGAGCACAGGCAGAGTGG + Intronic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1150774102 17:68065478-68065500 CAGCATGAGGGCAAGCGGAGTGG + Intergenic
1150875797 17:68968855-68968877 CTGCAAGAGCACCAGCAAAGGGG - Intergenic
1151202595 17:72479588-72479610 TAGAATGAGTTCAAGCAGAGTGG - Intergenic
1151518197 17:74610874-74610896 CAGCATAAGTGAAAGCAGAGAGG - Exonic
1151969624 17:77451012-77451034 CAGGCAGAGCACAAGGAGAGAGG + Intronic
1152042122 17:77910141-77910163 CAGCGTGAGGACAGGGAGAGGGG - Intergenic
1153681941 18:7509205-7509227 CAGCATGAACACCAGGAGAGAGG - Intergenic
1154019457 18:10650159-10650181 GAGCATGAACCGAAGCAGAGTGG + Intergenic
1154983183 18:21521486-21521508 CAGCATGAGAACAGGGAGAGGGG + Intronic
1155181979 18:23355953-23355975 CATGATGAGGTCAAGCAGAGTGG + Intronic
1155316035 18:24570992-24571014 CAGCATGGCCAAAAGCAGAAGGG - Intergenic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1157046579 18:44107420-44107442 CAGCAAGATGAGAAGCAGAGAGG - Intergenic
1157556607 18:48616881-48616903 CAGTGTGAGCAAAAGCACAGAGG + Intronic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1159556528 18:69951495-69951517 CAGCCTGAGGACAAACAGGGTGG + Intronic
1160007102 18:75075602-75075624 CAGCATGTCCAGGAGCAGAGGGG - Intergenic
1160640613 19:130814-130836 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1162306888 19:9880242-9880264 CAGCATGGGCAAAGGCAGGGAGG + Intronic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163502360 19:17684179-17684201 CAGCATGAGCAAAAGCATGGTGG - Intronic
1164649087 19:29879294-29879316 CAGCCTCAGCTCAAGGAGAGGGG - Intergenic
1165552280 19:36597471-36597493 CAGCATAAGTACAACCACAGTGG + Intronic
1165746110 19:38230095-38230117 CAGCCTGTGAACAAGCACAGGGG + Intergenic
1166590737 19:43996129-43996151 AAGCAGGAGCACATGAAGAGTGG + Exonic
1166617232 19:44261086-44261108 CAGGCTGAGCTCAGGCAGAGTGG + Intronic
1167586960 19:50380755-50380777 CAGCTGGAGCACAAGGAGATGGG + Intronic
1168163634 19:54530846-54530868 CAGCATAAGTAATAGCAGAGGGG - Intergenic
925641030 2:5985957-5985979 CAGGATGAGCTGAAGAAGAGGGG - Intergenic
925744963 2:7035970-7035992 GAGCATGAAAACCAGCAGAGTGG + Intronic
926706853 2:15843278-15843300 CAGAGGGAGCACAGGCAGAGAGG + Intergenic
927180787 2:20445571-20445593 CAGCCTGAACACAAGCAGGAAGG - Intergenic
927644782 2:24870688-24870710 GAGCCTGGGCACCAGCAGAGAGG - Intronic
928062867 2:28132574-28132596 CAGCTTTAGCAAAAGCACAGAGG - Intronic
928112744 2:28523857-28523879 CAGCCTGGGCCCAAGCAAAGGGG - Intronic
929868549 2:45738397-45738419 AGGCATGAGCAAAGGCAGAGAGG - Intronic
929875893 2:45796061-45796083 CAGCATGAGCAAAGGCACAGAGG - Intronic
929876498 2:45801053-45801075 CAGCATAAGTGAAAGCAGAGAGG + Intronic
930106955 2:47647836-47647858 CAGCATGAGCAAAGGCATAGAGG + Intergenic
930478048 2:51910177-51910199 CACCTTGACCACAAACAGAGAGG + Intergenic
930692770 2:54381252-54381274 CAGCATGAACAAAGGCATAGAGG - Intronic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
932588160 2:73045099-73045121 TAGCATGTGTACATGCAGAGGGG - Intronic
932670220 2:73731082-73731104 AAGCTTGAGCACAGGCAGAAGGG - Intronic
935623655 2:105150388-105150410 GATCATTAGCACCAGCAGAGGGG - Intergenic
936504225 2:113092253-113092275 AAGAACGCGCACAAGCAGAGAGG + Intergenic
936798577 2:116237741-116237763 CAGAATACGCACAGGCAGAGCGG - Intergenic
937040531 2:118817247-118817269 CAGCATGTGCAAAGGCAGGGAGG - Intergenic
937486867 2:122324456-122324478 CAGTATGAACCAAAGCAGAGGGG - Intergenic
937679235 2:124626420-124626442 GAGAATGAGAAGAAGCAGAGTGG + Intronic
937790446 2:125955144-125955166 CAGCATTTGCAAAAGCAAAGAGG - Intergenic
938290012 2:130144000-130144022 CAGCATGGGCACAGGCGAAGCGG + Intronic
938466512 2:131528937-131528959 CAGCATGGGCACAGGCGAAGCGG - Intronic
938923008 2:136012425-136012447 AAGCACGAGCAAAGGCAGAGAGG - Intergenic
939026496 2:137020226-137020248 TAGCTTGAGCAAAAGCAGAGGGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
940148396 2:150572527-150572549 TGGCATGAGCACAGGCATAGAGG + Intergenic
941063862 2:160878763-160878785 CAGCATGAACACAAGAAGACAGG + Intergenic
941713452 2:168739338-168739360 CACCATGAGCAAAAGCGGAGAGG + Intronic
941791315 2:169554952-169554974 CAGCATGGGCACTGGCAGAATGG + Intronic
942389048 2:175472950-175472972 CAGCATCAGCACAATCCCAGGGG + Intergenic
942408850 2:175685351-175685373 CAGCATGAGCAAAGGAAGAAAGG - Intergenic
942705728 2:178769742-178769764 CATCATGAACACCAGCACAGAGG - Exonic
946239781 2:218346440-218346462 CAGCATGAGCGAAGGCACAGAGG - Exonic
946411627 2:219518001-219518023 AAGCAAGAGCAGCAGCAGAGGGG - Intronic
946839068 2:223801804-223801826 CACCATAAAAACAAGCAGAGAGG + Intronic
947335695 2:229080373-229080395 CAGGATGTGCACAACCACAGAGG - Intronic
948481665 2:238254185-238254207 CAGCCTGAGCAAGATCAGAGGGG + Intronic
1168876378 20:1174851-1174873 CAGCATGAGCAGAGGCTCAGAGG - Intronic
1169846843 20:10003149-10003171 CAGCAAGGGCAAAGGCAGAGAGG - Intronic
1170370926 20:15647310-15647332 CAGCCTGGGCAAAAGCACAGGGG + Intronic
1170545592 20:17433505-17433527 CAACAGGAGCAGAGGCAGAGAGG + Intronic
1170803281 20:19607969-19607991 CAACATAAGCACAAGCACACAGG - Intronic
1170947003 20:20900476-20900498 CCGCCTGAGCACTAGGAGAGTGG - Intergenic
1171572764 20:26269454-26269476 CAGCATGTGCCCTAGAAGAGAGG + Intergenic
1172214556 20:33225791-33225813 CAGCATGTGCAAAGGCACAGTGG - Intronic
1172585693 20:36082744-36082766 CAGCATGAGCACAGTGAGACAGG - Intergenic
1172983608 20:38964231-38964253 CAGCATGAACAAAGGCAGAATGG + Intronic
1173168086 20:40700287-40700309 CAGCACAAACAAAAGCAGAGAGG - Intergenic
1173943907 20:46934771-46934793 CAGCATGAGCAAAGGCCCAGAGG + Intronic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174557701 20:51407602-51407624 CAGCATGAGCAAGAGCTCAGAGG - Intronic
1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG + Intergenic
1176268525 20:64223291-64223313 CAGCAAGAGGGCAACCAGAGAGG - Exonic
1176925291 21:14741701-14741723 AAGCTAGAACACAAGCAGAGAGG - Intergenic
1178260693 21:31097476-31097498 CAGAAGGAACACAAGGAGAGAGG - Intergenic
1178522475 21:33298008-33298030 CAGCTTGAGCAAAAGCAGTCTGG + Intergenic
1179085691 21:38215727-38215749 AAGCAGGAGCCCCAGCAGAGTGG + Intronic
1180703342 22:17793740-17793762 CAGCAAGGGCAGAAGGAGAGAGG + Intronic
1180978768 22:19868829-19868851 CAGCATGGGCAAAGGCACAGAGG + Intergenic
1181079402 22:20403954-20403976 CAGCATGTGCAGAAGCTCAGAGG - Intronic
1181124881 22:20696264-20696286 CATCAGGTCCACAAGCAGAGAGG + Intergenic
1181265346 22:21627962-21627984 CAGCATGAACAAAACCAGAATGG + Intergenic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1183101421 22:35586346-35586368 CAGCATAGGCACACTCAGAGAGG - Intergenic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183327606 22:37202943-37202965 CAGCATCAGCATTATCAGAGGGG - Intergenic
1183756814 22:39774911-39774933 CAGCATGAGCAAAAACACAGAGG - Intronic
1184145644 22:42608640-42608662 AAGGGTGAGCACAAGCAGCGAGG + Intronic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
950572890 3:13812988-13813010 CAGCATGTGCACAGGCCCAGAGG + Intergenic
951109132 3:18781000-18781022 CAACATAAGCAAAAGCAGACTGG + Intergenic
951270303 3:20616299-20616321 CAGCATTTGCAAAAGCAGAAAGG - Intergenic
951275429 3:20679398-20679420 TAGCATGTGCAAAGGCAGAGAGG + Intergenic
951469145 3:23036404-23036426 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
952514035 3:34085681-34085703 GAGCATGAGCCAAAGCAGGGCGG - Intergenic
952752527 3:36836854-36836876 CAGCAAGAGCTGAAGCAGAAAGG - Intronic
952843451 3:37667469-37667491 CAGCACGTCCACAGGCAGAGAGG + Intronic
952855772 3:37769654-37769676 CAGCATGTGCAAAAGCATAGAGG - Intronic
955603608 3:60674798-60674820 CACCATGAGGCCTAGCAGAGAGG - Intronic
955630341 3:60966403-60966425 GAGCATGAGCCAAAGCAGGGCGG - Intronic
955833701 3:63030887-63030909 CAGCGTGGGCAAAGGCAGAGAGG - Intergenic
956405430 3:68923867-68923889 CAGTATGAACCCAAGCAGTGTGG - Intronic
956460737 3:69469283-69469305 CAGCTAGAGAAGAAGCAGAGAGG + Intronic
957055356 3:75438330-75438352 CAGCATTAGGACAATCTGAGTGG + Intergenic
957498766 3:81026169-81026191 GTACATGTGCACAAGCAGAGGGG - Intergenic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
958108443 3:89107525-89107547 CAGCGTGCGCTGAAGCAGAGCGG - Exonic
959091891 3:101911680-101911702 AAGGATGAGCCAAAGCAGAGTGG - Intergenic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959653930 3:108779696-108779718 CAGCATGACTTAAAGCAGAGAGG - Intergenic
959766005 3:110029196-110029218 CAGCATGATCAAAGGCATAGAGG - Intergenic
961150004 3:124629565-124629587 CAGCAGGAACAAAAGCACAGAGG - Intronic
961329703 3:126131341-126131363 CAGTGTGAGCACATGCAGACTGG - Intronic
961595443 3:128012269-128012291 CAGCATCACCACACACAGAGAGG - Intergenic
961889029 3:130114715-130114737 CAGCATTAGGACAATCTGAGTGG + Intergenic
962113633 3:132477256-132477278 CAGCCTGAGTGCAAGCATAGTGG + Intronic
962580701 3:136795359-136795381 CAGCTTGAGCAAAGGCCGAGAGG + Intergenic
963464417 3:145660687-145660709 CAGCATGTGCAAATGCACAGAGG - Intergenic
963853953 3:150235293-150235315 CAGCATGGGCAAAGGCAGATTGG - Intergenic
964394730 3:156233624-156233646 CAGCAAGGGCAAAAGCAGAAAGG + Intronic
966305131 3:178523165-178523187 CAGCATGAGCACAAGCAGAGAGG + Intronic
966364266 3:179165789-179165811 CAGCATGAGCACAAGAACAGGGG - Intronic
966921341 3:184613607-184613629 CAGGATGTGCAAATGCAGAGAGG + Intronic
967420297 3:189264960-189264982 CAGCATGAAGATAAGCACAGGGG + Intronic
968403341 4:317248-317270 CAGCATGTGCAAAAGCACAGCGG - Intergenic
968998173 4:3958637-3958659 CAGCATTAGGACAATCTGAGTGG + Intergenic
969061225 4:4436869-4436891 CAGCATGAGCAAATGCTCAGAGG - Intronic
969166407 4:5319608-5319630 CAGCATGAACAAAGGCTGAGAGG - Intronic
969182502 4:5452956-5452978 CAGCATCAGTACAAGCAGACAGG + Intronic
969288671 4:6224405-6224427 CAGCAGGAGCAAAAGCAAACAGG - Intergenic
969377381 4:6771777-6771799 CAGCATTTGCAAAGGCAGAGAGG + Intergenic
969507779 4:7598836-7598858 CAGCATGAGCACAGCCTGGGGGG - Intronic
969662245 4:8537077-8537099 CAGCCTGAGCAAAGGCTGAGAGG + Intergenic
969755829 4:9150023-9150045 CAGCATTAGGACAATCTGAGTGG - Intergenic
970324066 4:14904828-14904850 TAGCATGTGCAAAAGCAAAGAGG - Intergenic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
971935361 4:33140675-33140697 CAAAATTAGCACAAGCAGATGGG + Intergenic
973638930 4:52884768-52884790 CAGCAGGAGCCCAAGGAGAGAGG - Intronic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
974062037 4:57043946-57043968 CAGCATGAGGGCCATCAGAGAGG - Intronic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974816580 4:67012748-67012770 TAGCATGAGCAATAGCATAGAGG + Intergenic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975487248 4:74948020-74948042 TGGCATGAGCAAAGGCAGAGAGG - Intronic
977412649 4:96687885-96687907 AAGCACAAGCACAAGCACAGTGG - Intergenic
978395475 4:108274915-108274937 CAGCAGAAGCCCAAGCACAGAGG - Intergenic
978885356 4:113761467-113761489 CAGGAGGAGTAGAAGCAGAGGGG + Intronic
978902549 4:113970137-113970159 CAGAATGAGCCAAAGAAGAGAGG + Intronic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
982381900 4:154757935-154757957 CAGGACGAGCACTAGCAAAGTGG - Intergenic
982693371 4:158572476-158572498 CAGCATGAACAAAGGCAAAGAGG + Intronic
982962338 4:161856261-161856283 CAGCATGAGAAAAGGCATAGAGG + Intronic
983836147 4:172387841-172387863 CAGCATGAGCAAAAAAACAGAGG - Intronic
985999187 5:3616728-3616750 CATCATGACCACAACCAGTGTGG - Intergenic
986785243 5:11108215-11108237 CAGCATGAACAGAAGCGTAGAGG + Intronic
986893850 5:12341541-12341563 CTGCAGGACTACAAGCAGAGAGG - Intergenic
988842646 5:35097893-35097915 GAGCCTGAGCTCAAGCTGAGAGG + Intronic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989225364 5:39021591-39021613 GAGCATGAGCACAAGCAAGGTGG - Intronic
989465747 5:41753446-41753468 CAGCATGAACAAAAGCTGAAAGG - Intronic
989986425 5:50704111-50704133 CAGCTTGTGCACTAGCAGAGAGG + Intronic
990135353 5:52638145-52638167 GAGCAAGAGCAAAACCAGAGGGG + Intergenic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
990372422 5:55134189-55134211 CAGTTTGATCACAAGCTGAGTGG - Intronic
991601780 5:68358301-68358323 AGGTATGAGCACAAGAAGAGTGG - Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
992486767 5:77204687-77204709 CAGCATGAACAAAGGCACAGAGG - Intergenic
992735392 5:79714197-79714219 CAACATGTGCAAAAGAAGAGGGG - Intronic
993069057 5:83135189-83135211 GAGCATGAGCCGAAGCAGGGTGG - Intronic
993337881 5:86683999-86684021 CAAAATGAGCATAAGAAGAGAGG + Intergenic
994737132 5:103569206-103569228 TGGAATGAGCACAAGCAGTGAGG - Intergenic
994794054 5:104270845-104270867 TAGCATGAGCAAATGCAGAGAGG + Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
995802959 5:116019695-116019717 CATCATGAGTACGAGCAGAGGGG + Intronic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
997196866 5:131986106-131986128 CAGCCTGGGCACAGGCACAGAGG + Intronic
997533769 5:134599815-134599837 CAGCATCAGAAAAAGCTGAGAGG + Intergenic
998127333 5:139633523-139633545 CTGCATGGGCACAACCTGAGAGG + Intergenic
998207450 5:140168279-140168301 CAGCATGACCTCTAACAGAGGGG + Intergenic
998282397 5:140823895-140823917 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998284322 5:140843444-140843466 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998287558 5:140877595-140877617 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998308502 5:141102616-141102638 CACCAGGAGCACATGCAGCGTGG - Exonic
998498621 5:142612856-142612878 CAGCGTGAGCACCAGCGAAGTGG + Intronic
998955161 5:147431183-147431205 CAGCATCAGTTCAAGAAGAGAGG + Intronic
999085454 5:148884759-148884781 CAGCATGAGCAAAGACTGAGTGG - Intergenic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
999694601 5:154178008-154178030 CAGCATGAGCAAAGGCATGGGGG + Intronic
999695614 5:154186239-154186261 CTGCTTTAGCACAAGGAGAGGGG + Intronic
999714488 5:154349193-154349215 CAGCATAAGCAAAAGCACTGAGG + Intronic
999907994 5:156164526-156164548 CAGCATGGGCAGGAGCAGACTGG - Intronic
1000138732 5:158380868-158380890 CAGCAAGGGCTTAAGCAGAGAGG - Intergenic
1000239526 5:159396629-159396651 CAACAGGAGGGCAAGCAGAGAGG + Intergenic
1000412362 5:160947051-160947073 GAGCATGAGCCGAAGCAGGGTGG - Intergenic
1000786440 5:165550046-165550068 CAGGGTGAGCTGAAGCAGAGTGG - Intergenic
1001164977 5:169356290-169356312 CAGCATGAGCAAAATCTGTGTGG + Intergenic
1001236171 5:170031422-170031444 CAACAGGAGCAGAAGCAGTGTGG + Intronic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001658278 5:173370903-173370925 CAAGATGACCACAAGCAGAGAGG - Intergenic
1001875198 5:175194303-175194325 CAGCATGGGCAAAGGCAGGGAGG + Intergenic
1002192944 5:177488270-177488292 CAGAGGGAGCACACGCAGAGAGG + Intronic
1002378769 5:178809278-178809300 CAGCATGGGAGCAAGCAGAAGGG + Intergenic
1002736737 5:181395605-181395627 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1002747962 6:79217-79239 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1003084314 6:3049339-3049361 CAGCATGAGCACCAGCTTTGAGG + Intergenic
1003091144 6:3104629-3104651 CAGCCAGGGTACAAGCAGAGAGG + Intronic
1004366049 6:15013606-15013628 CAGTATGGGCAAAGGCAGAGAGG - Intergenic
1004453756 6:15771833-15771855 CAGCATGTGCAAAGGCACAGAGG + Intergenic
1005801689 6:29431968-29431990 CAGGTTGAGCTCAAGCAGGGAGG - Exonic
1006303570 6:33206691-33206713 CAGCAGGAGGCCAGGCAGAGTGG - Exonic
1006686538 6:35839540-35839562 GACCATGAGCACAACCAGGGAGG + Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006818754 6:36873715-36873737 CAGCATGAGCAAATAGAGAGAGG + Intronic
1007084980 6:39137219-39137241 TAGCATGAGAAAAAGCAGAGTGG + Intergenic
1007385038 6:41514799-41514821 CAGCAACAGGCCAAGCAGAGGGG - Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1009705170 6:67239815-67239837 TGGCATCAGCACCAGCAGAGTGG - Intergenic
1009990992 6:70842753-70842775 CAGAATGAGGAGAAGCAAAGAGG - Intronic
1010004519 6:70981090-70981112 AAGCATGAGCACCTCCAGAGAGG + Intergenic
1010387694 6:75301557-75301579 TAGCATTAGCAGAAGTAGAGAGG + Intronic
1010397227 6:75406327-75406349 CAACATGAACAGAATCAGAGTGG - Intronic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012799010 6:103801997-103802019 GAGCATGAGCCGAAGCAGGGCGG + Intergenic
1012933194 6:105338564-105338586 GAGCATGAGCCGAAGCAGGGCGG + Intronic
1013722576 6:113048610-113048632 CAGCATGTGCAAAAGCACAAAGG - Intergenic
1015718468 6:136216061-136216083 CAGCATGAGCTGCAGGAGAGAGG + Intergenic
1016381520 6:143487663-143487685 CAGCATGAACAGTAGCAGACAGG - Intronic
1016875911 6:148864468-148864490 GAGCATGAGCCGAAGCAGGGCGG - Intronic
1018184212 6:161251812-161251834 CAGGAGGAACAAAAGCAGAGAGG + Intronic
1018329199 6:162709593-162709615 CAGCATGAGCACCAGCATATTGG - Intronic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1019241836 6:170671134-170671156 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1022472480 7:30690294-30690316 CAGCATGTGCAAAGGCAGAGAGG + Intronic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1022597713 7:31728472-31728494 CAGCATAGGCAAAAACAGAGGGG - Intergenic
1022872918 7:34498173-34498195 AAGCAAGAGCAGAAGCTGAGAGG - Intergenic
1023119988 7:36899448-36899470 CAGCATGAGCAAAGGCAAGGAGG + Intronic
1023464108 7:40434859-40434881 CAGCATCAGAAAAAGCATAGGGG - Intronic
1025027283 7:55526968-55526990 CAGCTTGAGCCCAATTAGAGTGG + Intronic
1026390328 7:69894812-69894834 AAGCATGAGCAAATGAAGAGTGG - Intronic
1026537943 7:71255771-71255793 CAGCATGAGTAAAGGCATAGTGG + Intronic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1029727368 7:102415948-102415970 CAGCCTAAGCACATGCAGCGAGG - Intronic
1030084602 7:105805767-105805789 CAGCAAGAGCAAATGCAGTGTGG + Intronic
1030142568 7:106320319-106320341 GAGCATGAGCCAAAGCAGGGAGG + Intergenic
1030401628 7:109059067-109059089 CTGCATGTGCACCAGCAGAGAGG + Intergenic
1031422863 7:121570053-121570075 AAGCAAGAGGAAAAGCAGAGGGG - Intergenic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1033155940 7:138957107-138957129 CAGCATGTGCAAAGGCACAGGGG + Intronic
1035506281 8:136962-136984 CAGCATGAGCAAATGCAAGGAGG + Intergenic
1035657445 8:1320552-1320574 CAGGCTGAGCTCAAGCACAGGGG - Intergenic
1036379071 8:8225324-8225346 CAGCATTAGGACAATCTGAGTGG - Intergenic
1036690782 8:10943489-10943511 CAGCAGGAGCAGATACAGAGAGG - Intronic
1036871858 8:12439560-12439582 CAGCATTAGGACAATCTGAGTGG + Intergenic
1037422992 8:18724179-18724201 CAGCATCAGGACGAGTAGAGGGG + Intronic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1037996980 8:23359860-23359882 CAGCATGGGCAGAGGCACAGAGG - Intronic
1038423145 8:27446357-27446379 CAGCCTGAACAAAAGCAGAAAGG - Intronic
1038630063 8:29233248-29233270 TAGCAAGAGAACAATCAGAGAGG + Intronic
1038722506 8:30049676-30049698 CATCATGACAACAAGCAGATTGG - Intergenic
1039844194 8:41314161-41314183 CAGCATGAGCCCAGGATGAGAGG - Intergenic
1041150028 8:54922558-54922580 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1041374288 8:57196639-57196661 CAGCCTGAGAGCAAGCTGAGAGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1043118240 8:76286849-76286871 GACGATGAGCAGAAGCAGAGTGG - Intergenic
1043314538 8:78903874-78903896 CAGTATGAGCACAAGCTGAGAGG - Intergenic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044409109 8:91865652-91865674 CAGACTGACCTCAAGCAGAGGGG - Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045367325 8:101488657-101488679 CAGCATGAGAAAGAGGAGAGAGG + Intergenic
1045799421 8:106084905-106084927 GAGAAAGAGCAGAAGCAGAGTGG - Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047247591 8:123158683-123158705 CAGTATGAGTACAAGCAGGTAGG + Intergenic
1047351208 8:124076357-124076379 CAGCAGGAGCAAATGCAGAAAGG - Intronic
1047478153 8:125255542-125255564 CAGTGTGATCACAAGCAGAGAGG + Intronic
1048001492 8:130383003-130383025 CAGCATGTGCAAAGGCACAGAGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048476424 8:134745980-134746002 CAGGAAGAGCACAGGCAAAGGGG - Intergenic
1049095241 8:140544717-140544739 CAGCATGGGCAGACGCTGAGAGG + Intronic
1049239015 8:141527299-141527321 AAACATGTGCACAAGCACAGAGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1050488515 9:6162067-6162089 CATCATGAGTGAAAGCAGAGAGG - Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051146515 9:14032888-14032910 CAGATTGAGCAAAAGCTGAGTGG + Intergenic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051596727 9:18831398-18831420 CAGCCTGGTCACAAGCAGGGTGG + Intronic
1052710062 9:32043234-32043256 AATCATGAGCACAAGCATGGAGG - Intergenic
1052937840 9:34108105-34108127 CAGCAAGAGCAAAGGCAGGGAGG - Intronic
1053150949 9:35742390-35742412 AAGCATGAGCACAGGCATGGAGG - Intronic
1053286328 9:36851717-36851739 CTGCATGAGCAAAGGCAGGGAGG + Intronic
1053366778 9:37528434-37528456 CAGCATGAGCAAAGGCAGCAGGG - Intronic
1053465972 9:38308814-38308836 CAGCATGATCAAAGGCACAGGGG + Intergenic
1053582926 9:39425791-39425813 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1053847109 9:42250656-42250678 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054104505 9:60984534-60984556 GAGCATGAGCCAAAGCAGGGCGG + Intergenic
1054182530 9:61921507-61921529 CAGCATGTGCCCTAGAAGAGAGG - Intergenic
1054655978 9:67666972-67666994 CAGCATGTGCCCTAGAAGAGAGG + Intergenic
1054962100 9:70980344-70980366 CAGCATGATCACAGTCAGAAGGG + Intronic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1056090958 9:83205454-83205476 CAGCATGAGCATAGTCACAGAGG - Intergenic
1056204979 9:84311131-84311153 CAGCAGAAGCACAATCACAGTGG - Intronic
1056456274 9:86764002-86764024 CAGCATGAGCAAAGGCACAGAGG + Intergenic
1057302597 9:93895488-93895510 CTCCATGAGCACACGGAGAGGGG - Intergenic
1057407256 9:94784164-94784186 TAGCCTCTGCACAAGCAGAGTGG + Intronic
1057804933 9:98213045-98213067 CAGCATGGGGACCAGCAGAGGGG + Intronic
1058186671 9:101863584-101863606 CAGCACAAGCAGAAGCATAGAGG - Intergenic
1059541446 9:115134423-115134445 CAGCATATGCAAAAGCAAAGAGG + Intergenic
1059753041 9:117266922-117266944 CAGCATACGCTCAAGAAGAGGGG - Intronic
1060046599 9:120346424-120346446 CAGCATGATCTCAACCACAGTGG + Intergenic
1060273326 9:122163583-122163605 CAGCATGAGCAATAGCCCAGAGG + Intronic
1060290017 9:122293367-122293389 CAGCTTCAGCACAAGCTGTGTGG - Intronic
1060307681 9:122430908-122430930 CACCTGAAGCACAAGCAGAGAGG - Intergenic
1060733734 9:126053335-126053357 CAGCATGGGCAAAAGCAAGGAGG - Intergenic
1060922777 9:127434132-127434154 CACCATGAGCAGAAGCATGGAGG - Intronic
1061608375 9:131729161-131729183 CAGCATGAGCCTGAGCTGAGAGG - Intronic
1062163800 9:135095434-135095456 AAGCATAAACACCAGCAGAGAGG - Intronic
1062368243 9:136222368-136222390 CAGCCTGAGCAGAACCAGACAGG - Intronic
1062381628 9:136289756-136289778 CTCCATGAGAACAAGCACAGTGG + Intronic
1062621753 9:137425968-137425990 TACCATGAGCACAAGGACAGAGG - Intronic
1203602027 Un_KI270748v1:20368-20390 CAGCATGAGCAAATGCAAGGAGG - Intergenic
1185773848 X:2786553-2786575 CAACATGAGGACAGGCACAGTGG - Intronic
1186643532 X:11482518-11482540 CAGTATGAGCACAAGGAAGGTGG - Intronic
1187191907 X:17043540-17043562 AAGCATCAGCACAAGCTGGGAGG - Intronic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1189398797 X:40646698-40646720 CATCATGAGCACAGGCAGGGAGG - Intronic
1189619969 X:42825557-42825579 CAGCATGAACACAACAAGAAAGG - Intergenic
1190744261 X:53312126-53312148 CAGCATGAGCAAACACACAGAGG - Intronic
1190912683 X:54787248-54787270 CAGCATGTGCAGAGGCACAGAGG - Intronic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193652547 X:84155748-84155770 CAGCATGGGAACAAGGAGATAGG + Intronic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1196091130 X:111744693-111744715 CAGCATGAGGAATAGCAGAATGG - Exonic
1197172366 X:123448530-123448552 CAGCTTAAGGAAAAGCAGAGAGG - Intronic
1197779390 X:130144507-130144529 CAGCATAAGCAAAAGCACAAGGG - Intronic
1197834167 X:130677061-130677083 CAGCATGAGCAAAAGTACAAAGG - Intronic
1197840449 X:130740631-130740653 CAGCATGAGCTAAACCAAAGGGG + Intronic
1197920482 X:131588061-131588083 CAGCAAGTTCACAAGCAGGGAGG - Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199533038 X:148871102-148871124 CTGCATGAGAAAAAGCAGTGTGG + Intronic
1199608504 X:149594854-149594876 CAGAATGTGCACATGCAGATGGG - Intergenic
1199630618 X:149774506-149774528 CAGAATGTGCACATGCAGATGGG + Exonic
1202057348 Y:20848667-20848689 AAGCATGGGCCAAAGCAGAGTGG - Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic