ID: 966305358

View in Genome Browser
Species Human (GRCh38)
Location 3:178527008-178527030
Sequence ATGTCTACATATATGAATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966305358_966305360 20 Left 966305358 3:178527008-178527030 CCGCCATTCATATATGTAGACAT 0: 1
1: 0
2: 3
3: 13
4: 229
Right 966305360 3:178527051-178527073 TGAGATTATTTTCTAACAGAAGG 0: 1
1: 0
2: 4
3: 34
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966305358 Original CRISPR ATGTCTACATATATGAATGG CGG (reversed) Intronic
900869239 1:5289973-5289995 ATGGATACATGGATGAATGGTGG + Intergenic
901888098 1:12238283-12238305 ATGTATACATACAGGCATGGTGG + Intronic
903451888 1:23459274-23459296 ATGTTTACCTAAATGAATGATGG + Intronic
905072324 1:35237861-35237883 ATATATATATATATGAATGTCGG + Intergenic
907722251 1:56983014-56983036 ATGTCTATATATATATATGATGG - Intergenic
909107164 1:71426043-71426065 ATGTATGCATATATGTATGTAGG - Intronic
909350727 1:74650164-74650186 ATGTCTAGATATATATAAGGAGG - Intronic
910284089 1:85533901-85533923 ATGGCTGCATATTTGGATGGCGG + Intronic
911252918 1:95598880-95598902 ATGTCCACAAATATTACTGGTGG - Intergenic
912573629 1:110643781-110643803 ATATCTAAAAATATGTATGGAGG + Intergenic
912908431 1:113732007-113732029 ATGTATACATATATTTTTGGAGG - Intronic
914205931 1:145529083-145529105 ATGGCTGCATATCTGGATGGCGG - Intergenic
916740285 1:167641372-167641394 ATCTCTAAATAAATGAATGAAGG - Intronic
917528832 1:175814811-175814833 ATGAAATCATATATGAATGGAGG + Intergenic
918077386 1:181180866-181180888 GTGACTACATATATGAAGAGTGG - Intergenic
918761036 1:188407703-188407725 ATGTCTACCTTTATGCTTGGTGG + Intergenic
918844140 1:189586833-189586855 ATGCATTCATATATGAATGTAGG - Intergenic
918850779 1:189686759-189686781 ATATATACATATATGTATGATGG - Intergenic
919149289 1:193674656-193674678 TTGTCTACATAGATGGTTGGTGG + Intergenic
920823140 1:209400139-209400161 ATATATATATATATGAATGCAGG - Intergenic
921121850 1:212144178-212144200 TTGACTAAATAAATGAATGGCGG + Intergenic
922951899 1:229565369-229565391 ATATATATATATATGAATGATGG + Intergenic
923298795 1:232621327-232621349 GTGTGTGCATATAAGAATGGCGG - Intergenic
923906070 1:238386314-238386336 ATGTGTACATATATGTGTGTGGG + Intergenic
1063209407 10:3865059-3865081 ATATATACATATATATATGGTGG + Intergenic
1065195241 10:23257914-23257936 GTGTATACATATATGTGTGGGGG - Intergenic
1065412461 10:25444269-25444291 ATGTGTATATATGTGAGTGGGGG + Intronic
1068063083 10:52094486-52094508 ATGTTTAAATATATGAACGGTGG - Intronic
1068312596 10:55297094-55297116 GTGTTTACATATTTCAATGGGGG + Intronic
1068319075 10:55386961-55386983 ATGTCCACATATATTTTTGGAGG + Intronic
1069040648 10:63692296-63692318 ATGTTCACACATATGAATTGAGG - Intergenic
1069429531 10:68321866-68321888 AAGACTACATAAATAAATGGAGG + Intronic
1070299512 10:75193034-75193056 ATGTCTAAAAATATGATTGCTGG - Intergenic
1070981956 10:80655588-80655610 ATGTCTAGATTTCTGAACGGGGG + Intergenic
1076039840 10:127236795-127236817 CTGGCTACATAAATGAATGGTGG - Intronic
1077965466 11:7127821-7127843 ATATATATATATATAAATGGGGG - Intergenic
1079467609 11:20746466-20746488 TTTTCTACATATGTGAAGGGAGG - Intronic
1079478367 11:20855561-20855583 GGGTCTATATAGATGAATGGAGG + Intronic
1080897229 11:36456797-36456819 ATGTGAACATACATGCATGGAGG + Intronic
1081309891 11:41557088-41557110 AAGTCAACATATATGCATAGAGG - Intergenic
1084314894 11:68339807-68339829 ATGTGTACATACATGAGTAGAGG + Intronic
1086511118 11:87559178-87559200 ATATTTAAATAAATGAATGGTGG + Intergenic
1086627340 11:88972521-88972543 ATGGATACATATATAAATTGGGG + Intronic
1087952532 11:104240571-104240593 ATGTATATATGTATGTATGGAGG + Intergenic
1088010167 11:104991115-104991137 ATAGCTACATATATGAATGGAGG + Intergenic
1088713757 11:112530680-112530702 ATATATATATATATGAATGATGG - Intergenic
1088983607 11:114886730-114886752 ATGTGTATATGCATGAATGGAGG - Intergenic
1089027752 11:115289423-115289445 TTGTCTACCTTTAAGAATGGTGG + Intronic
1090543228 11:127731992-127732014 ATGTCTACATTTTTCTATGGGGG + Intergenic
1095245751 12:39919141-39919163 GTGTATACATATATGTATGCAGG - Intronic
1095760513 12:45829190-45829212 ATCTATACATATATGATTGGTGG - Intronic
1097385387 12:58944623-58944645 ATATATATATATATGAATGATGG - Intergenic
1097547268 12:61019606-61019628 ATATATATATATATGTATGGTGG - Intergenic
1098008523 12:66024639-66024661 ATATATAGATATATGAATAGAGG + Intergenic
1099796320 12:87405164-87405186 TTGGCTACATATATGCTTGGAGG + Intergenic
1100035393 12:90244875-90244897 TTCTCTCCATAAATGAATGGGGG - Intergenic
1100511637 12:95280453-95280475 GTGTGTACACATATGAAAGGGGG - Intronic
1100511643 12:95280508-95280530 GTGTGTACACATATGAAAGGGGG - Intronic
1101002808 12:100373546-100373568 TTGTGTCCATATATGAATGAAGG - Intronic
1101022941 12:100572459-100572481 AGGTCTCCATCTGTGAATGGTGG - Intergenic
1101291446 12:103373873-103373895 GTGTCTAAATATATAAATGTTGG + Intronic
1107934353 13:45332483-45332505 ATGCATACATAAATGAATGGAGG + Intergenic
1108243451 13:48491620-48491642 AAGTCTACAGAGAGGAATGGAGG + Intronic
1108511934 13:51164173-51164195 ATGTCTACTGATATGAAGTGTGG + Intergenic
1109637166 13:65136477-65136499 ATATTTACATATATGAAATGAGG - Intergenic
1109774458 13:67021902-67021924 ATGTGTATATATATGTATGTAGG + Intronic
1112097817 13:96153766-96153788 ATGTCAACCTTTATTAATGGAGG + Intronic
1112142591 13:96661957-96661979 AAGTCTACTTTTATGACTGGTGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1112928136 13:104702671-104702693 ATGTGCAAATATATGAATGGTGG - Intergenic
1113106380 13:106775876-106775898 ATGTTTACACATAAGAAAGGAGG - Intergenic
1113118997 13:106906298-106906320 ATGTATACATATTTAAATGATGG + Intergenic
1115037597 14:28878359-28878381 ATGTATATATATATGAATATAGG + Intergenic
1115434668 14:33359137-33359159 ATGACTGAATATATGAATGGAGG + Intronic
1117012306 14:51483393-51483415 ATGTGTTCAAAAATGAATGGGGG + Intergenic
1119191907 14:72688673-72688695 ATGTACACATACATGAATGAAGG - Intronic
1119757324 14:77128316-77128338 AAGTCTGCATTTAGGAATGGTGG - Intronic
1121362785 14:93277295-93277317 ATGTTTACATTTAAGCATGGGGG + Intronic
1124068227 15:26366005-26366027 ATGTATACATATGTGTAAGGAGG - Intergenic
1125753675 15:42047687-42047709 GTGTATATATGTATGAATGGGGG - Intronic
1126380174 15:48038493-48038515 ATGACTACATATGTGAATTAGGG + Intergenic
1126938689 15:53741187-53741209 ATTTGTAAATATTTGAATGGGGG - Intronic
1128903054 15:71442690-71442712 ATATATATATATATGAAGGGAGG + Intronic
1130744522 15:86636694-86636716 ATATATATATATATGACTGGTGG - Intronic
1131460955 15:92617226-92617248 ACGTCTACATATACAATTGGAGG - Intergenic
1134214196 16:12303708-12303730 ATATCTACATATAGGAAATGAGG - Intronic
1135704185 16:24660437-24660459 ATATATATATATATGAATGATGG - Intergenic
1137640095 16:50021515-50021537 GTGTCTACATTTATGGATAGAGG - Intergenic
1138544605 16:57708551-57708573 ATGTATACAAATATTCATGGCGG - Intronic
1139274259 16:65712873-65712895 ATATATACATATATAAAAGGAGG + Intergenic
1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG + Intronic
1155607789 18:27627715-27627737 ATGTCTACCTATATGAAAAAGGG - Intergenic
1155702963 18:28771015-28771037 GAGTGTAAATATATGAATGGTGG + Intergenic
1156084449 18:33382240-33382262 ATGTATACATATATCTATTGGGG - Intronic
1156998886 18:43500201-43500223 ATGTCTACCTAGATTAAGGGTGG - Intergenic
1157955142 18:52088547-52088569 ATGCCTACATTTATGCATGGTGG - Intergenic
1158289899 18:55928643-55928665 ACATATACATATATAAATGGGGG + Intergenic
1159484472 18:69036997-69037019 ATGTGTATATATATGTGTGGGGG + Intronic
1159748623 18:72271861-72271883 ATGTCTTCACATACGAATTGTGG + Intergenic
1159797276 18:72860167-72860189 ATGTCAACATATATGTATCCCGG + Intronic
1160624803 18:80196159-80196181 ATGTAGACATACATCAATGGTGG - Intronic
1162171014 19:8788970-8788992 ATGTCTACTGGAATGAATGGGGG - Intergenic
1163058647 19:14741912-14741934 ATGTCTACATTAATAAATGTTGG + Intronic
1163128055 19:15255088-15255110 CTTTCTACATATCTGACTGGTGG - Intronic
1166090976 19:40508696-40508718 ATATATATATATATGACTGGTGG + Intronic
1166207604 19:41282136-41282158 ATGTGTACAAATATGAAGGAAGG - Intronic
1166648471 19:44551545-44551567 ATATATATATATATGAATGATGG + Intergenic
1168318618 19:55495208-55495230 ATATATATATATATGAAAGGAGG - Intronic
1168554976 19:57330573-57330595 ATCCCTACATATATGCATGCCGG - Exonic
928204408 2:29273760-29273782 ATGTATAAATTTATAAATGGAGG - Intronic
929725139 2:44417430-44417452 ATGAATACATAAATGAATTGTGG - Intronic
930588961 2:53304184-53304206 ATGTTTTCATGTAAGAATGGTGG + Intergenic
931250943 2:60530056-60530078 ATGCATTCATATATGAATGTTGG - Intronic
932675371 2:73775990-73776012 ATGTCTACATATATGAAGGATGG + Intronic
937041988 2:118829651-118829673 ATTACTACATGTCTGAATGGTGG - Intergenic
939087275 2:137736558-137736580 ATATATATATATATGAATGATGG + Intergenic
940233932 2:151489330-151489352 ATTTCTATATATATTAATAGGGG + Intronic
940473325 2:154127837-154127859 GTATATACATATATGAATGCAGG - Intronic
940552245 2:155174363-155174385 ATATATATATATATGAATGATGG - Intergenic
941128535 2:161617312-161617334 GTTTCTTCATATATAAATGGAGG + Intronic
941189770 2:162366758-162366780 ATGTATAAGTTTATGAATGGTGG + Intronic
942434037 2:175951576-175951598 ATATATATATATATGAATGATGG - Intronic
942557171 2:177183818-177183840 ATGTATCTATATATGTATGGTGG - Intergenic
943079729 2:183244113-183244135 ATTTATACATAGATGAATGCTGG - Intergenic
943432488 2:187822079-187822101 ATGTATACAAATATAAATAGTGG - Intergenic
943492959 2:188580229-188580251 ATCTCTACATAAATAGATGGAGG + Intronic
943514963 2:188873899-188873921 ATGTATACATAGATGAAGTGGGG - Intergenic
943709393 2:191073714-191073736 ATGTTTATATTTATGTATGGTGG - Intronic
945599115 2:211836215-211836237 GTGTCTATATATCTGAATGAAGG - Intronic
947179329 2:227398252-227398274 ATGTCTACAAATGTGAGTGCAGG - Intergenic
1169154889 20:3321432-3321454 ATATCTACACATAGAAATGGTGG + Intronic
1171093553 20:22309634-22309656 GTGTGTACATTTGTGAATGGTGG + Intergenic
1171283468 20:23919786-23919808 ATGTGTACATACATGTATGTGGG - Intergenic
1174856885 20:54054374-54054396 GTGTATACATATATGTATAGAGG - Intronic
1175654311 20:60755399-60755421 ATGTAAACATTTCTGAATGGCGG - Intergenic
1179144441 21:38754978-38755000 ATGCATACATATAAAAATGGTGG + Intergenic
1181821156 22:25476699-25476721 ATGTCTCCATCTGTGAATGAAGG - Intergenic
1181895949 22:26107548-26107570 ATATATATATATAAGAATGGTGG + Intergenic
1183617147 22:38952857-38952879 ATTTCTACACATAGGAAGGGTGG + Intronic
949807256 3:7969234-7969256 ATGGCTATATACATGGATGGGGG + Intergenic
951612508 3:24506640-24506662 ATATATATATATATAAATGGAGG + Intergenic
952635234 3:35521163-35521185 ATATCTACATATATGGAATGAGG + Intergenic
952636754 3:35542355-35542377 GTGTGTACATTTATGAATGAAGG - Intergenic
953205206 3:40821096-40821118 GTGTGTATATATATGAATGCTGG + Intergenic
956395337 3:68820034-68820056 AAGTGTACATAAATGAATGAAGG + Intronic
957056600 3:75447974-75447996 ATATATATATATATGTATGGTGG - Intergenic
958682325 3:97346930-97346952 ATGACTCCATAAATGAATGAAGG + Intronic
959827177 3:110812296-110812318 ATATATACATATATGGAAGGAGG - Intergenic
963485194 3:145927090-145927112 ATGTCTACAGAGATGGATGAGGG + Intergenic
963570800 3:146993018-146993040 ATATATACATATATGTATAGAGG + Intergenic
964783272 3:160364545-160364567 ATGCATACATATATTTATGGTGG + Intronic
965215475 3:165858797-165858819 ATATCAAGATATATGAATTGAGG - Intergenic
966305358 3:178527008-178527030 ATGTCTACATATATGAATGGCGG - Intronic
966616015 3:181913433-181913455 ATGTCTTCACATATGACTGGTGG - Intergenic
969039454 4:4283931-4283953 AGTTTTACTTATATGAATGGTGG - Intronic
971080438 4:23203956-23203978 ATGTTCACATTTATAAATGGGGG - Intergenic
971999831 4:34017266-34017288 GTGTGTGCATATATGTATGGTGG + Intergenic
974779990 4:66542466-66542488 AAGACTACATATATGAATACTGG - Intergenic
975233823 4:71967850-71967872 GTGTGTGCATATATGAATTGAGG - Intergenic
975270179 4:72422344-72422366 ATCTCTGCATATATCAATGCAGG - Intronic
978642274 4:110884760-110884782 ATATATATATATATGAATGAAGG + Intergenic
978878823 4:113675447-113675469 AAGTTTACAAACATGAATGGAGG + Intronic
979155217 4:117378435-117378457 ATGAATACATAAATAAATGGGGG + Intergenic
979506193 4:121500580-121500602 ATGTTTAAAGATATGAATTGAGG + Intergenic
980091809 4:128450805-128450827 ATGTCTTCATATACAACTGGTGG - Intergenic
981971078 4:150662517-150662539 TTGTCTACATATTGGAATGTAGG - Intronic
982583835 4:157212170-157212192 ATCTATTCATATATCAATGGTGG + Intronic
982611255 4:157576375-157576397 ATGTTTGCATATATAAATGCAGG + Intergenic
983063570 4:163185255-163185277 CTGTCTACAGATAAAAATGGTGG + Intergenic
983558361 4:169077976-169077998 ATGTCTACATATAATTAGGGTGG - Intergenic
986410017 5:7468290-7468312 AGGTGTAAATATATGAATGAAGG + Intronic
987151692 5:15047028-15047050 ATGTATACATATATGTATATGGG - Intergenic
987181567 5:15373325-15373347 ATGACTTCAGATATTAATGGTGG - Intergenic
987526369 5:19055492-19055514 CTGTATACATATGTGAATGTGGG - Intergenic
988126157 5:27040677-27040699 ATGTCTAAATACATAAAAGGAGG - Intronic
989303548 5:39924340-39924362 ATGTTGATATATATGAGTGGTGG + Intergenic
989315078 5:40069110-40069132 ATATCCACAAAAATGAATGGAGG + Intergenic
990470235 5:56108586-56108608 ATGTATACAAATATGAGTGAGGG + Intronic
990961239 5:61395425-61395447 CTGTGTACAGGTATGAATGGGGG - Intronic
992544084 5:77794176-77794198 ATGGCTACATATATCCATGGGGG - Intronic
993629100 5:90262461-90262483 ATGTATATGTATAGGAATGGAGG + Intergenic
993681059 5:90878744-90878766 ATTTATACAGATATGAAAGGAGG + Intronic
995024682 5:107406238-107406260 ATGTATACAAATATTAATTGTGG + Intronic
996694384 5:126377539-126377561 TTGGCTACATATCTGACTGGAGG - Intronic
997318337 5:132956716-132956738 ATGTTTACATTTTTAAATGGTGG - Intronic
998832702 5:146176620-146176642 ATCTCAACATATATGAATCTGGG + Intronic
1000905941 5:166965906-166965928 ATATATAAATAAATGAATGGCGG - Intergenic
1001876684 5:175207714-175207736 ATGTTTAAATATATGACTGAGGG + Intergenic
1002957740 6:1884392-1884414 AAGTCTACAAATAGGACTGGTGG + Intronic
1002997016 6:2296506-2296528 ATGTATACATATGTGTGTGGGGG + Intergenic
1003085979 6:3061977-3061999 ATGTATAAATATATGTATAGAGG - Intergenic
1005506335 6:26472025-26472047 ATGTCAATAAATATGGATGGTGG + Intronic
1006558799 6:34891021-34891043 ATTTCTAAATAAATGGATGGTGG + Intronic
1007597178 6:43058561-43058583 AATTCTTCACATATGAATGGAGG + Intronic
1008603283 6:53116546-53116568 GTGTGTACAAATATGAATGAGGG + Intergenic
1011674576 6:89719811-89719833 ATATCTACATAAATGTTTGGAGG - Intronic
1012944621 6:105451996-105452018 GTGTCCACATGCATGAATGGAGG + Intergenic
1013444440 6:110208288-110208310 ATGTCTACCTATATTAATTCAGG - Intronic
1013570776 6:111423055-111423077 ATGACTACATTTATGAATAAAGG - Intronic
1013647009 6:112154781-112154803 CTGTCTACGTGTATGAAAGGAGG + Intronic
1013914334 6:115316662-115316684 ATGTGTACATACATGTATGTGGG + Intergenic
1013941188 6:115665030-115665052 ATGTCTATATGTATGTATGTAGG + Intergenic
1014863578 6:126500653-126500675 ATATATAGAAATATGAATGGAGG - Intergenic
1014886378 6:126786495-126786517 GTGTGTGCATATATGAATGTAGG + Intergenic
1016723989 6:147338616-147338638 ATGTCTACCTAAATTTATGGAGG - Intronic
1023161148 7:37297068-37297090 AAGTGTAAATATATGCATGGGGG + Intronic
1024350554 7:48358570-48358592 GTTTCTACATAGATGAATAGAGG - Intronic
1024908477 7:54417547-54417569 ATATTTACTTATATGAATGAGGG - Intergenic
1026413078 7:70146953-70146975 ATGTGTACATATATGTAGGTAGG + Intronic
1027471125 7:78575501-78575523 AGGACTACATAAATGAAAGGGGG + Intronic
1028247478 7:88498562-88498584 CTGTCAACATATCTGAATAGGGG + Intergenic
1030431899 7:109458861-109458883 ATATATACATATATAAATGTAGG - Intergenic
1030942902 7:115677679-115677701 ATGTATACATATATGTAATGGGG + Intergenic
1033478760 7:141717199-141717221 ATTTCAACATTTTTGAATGGTGG + Intronic
1034514951 7:151569201-151569223 ATGTCTACAAAAAAGAAAGGTGG - Intronic
1035852166 8:2931457-2931479 ATATATATATATATGAATGATGG + Intergenic
1036739786 8:11349355-11349377 ATATATACATATATGCATGCAGG + Intergenic
1037174824 8:15934686-15934708 ATGTTTAAATATATGAATGTAGG + Intergenic
1039215942 8:35271507-35271529 ATGTATACATATATGTATACAGG + Intronic
1039331113 8:36537822-36537844 ATATATATATATATGAATGGCGG + Intergenic
1039351238 8:36766235-36766257 ATGACTGCATATGGGAATGGTGG - Intergenic
1043268460 8:78298234-78298256 ATGTCTACATTTATAGATGATGG + Intergenic
1045068165 8:98471189-98471211 AGCTCTACAGATATGAATAGTGG + Intronic
1046328879 8:112686916-112686938 ATGTCCATATAAATTAATGGAGG - Intronic
1049821977 8:144640984-144641006 ATGTCTATATAGATGAAGAGTGG - Intergenic
1051200674 9:14618951-14618973 ATGTCTAAACAGATGGATGGTGG - Exonic
1051612468 9:18974705-18974727 ATATATACATGTATAAATGGGGG + Intronic
1054968198 9:71054063-71054085 AGGCATACATATATCAATGGTGG - Intronic
1055608349 9:77995183-77995205 ATTTCTTCATCTATAAATGGGGG - Intronic
1056220593 9:84447458-84447480 ATGTTGAAATATATGAATGTAGG + Intergenic
1059333531 9:113553066-113553088 ATGTCTACATATGTGCATGGGGG - Intronic
1060510165 9:124225982-124226004 ATGTATACACATATGCATGCAGG - Intergenic
1186970215 X:14833817-14833839 GTGTGTACATATATAAATAGTGG - Intergenic
1187508507 X:19896935-19896957 ATGAATACATATGTGATTGGTGG + Intergenic
1187963404 X:24587366-24587388 ATGTCTGCAGATTTGAAGGGGGG + Intronic
1188678234 X:32969247-32969269 GTGTGTACATATATGGGTGGTGG - Intronic
1189077974 X:37938011-37938033 ATTACTACATAGATGATTGGGGG + Intronic
1189272807 X:39763527-39763549 ATGTGTATATATATGAATATGGG - Intergenic
1189962661 X:46339248-46339270 ATATATATATATATGAATGATGG + Intergenic
1190103646 X:47542775-47542797 ATGTCTACATATATGTACATAGG - Intergenic
1190487751 X:50945299-50945321 ATATATAAATATATAAATGGAGG - Intergenic
1194303331 X:92213531-92213553 ATGTATAAATATAAGAATAGAGG - Intronic
1195845777 X:109226371-109226393 AAGTCCACAGATATGAATGAGGG + Intergenic
1199965885 X:152820573-152820595 ATATATACATATATGAATACTGG - Intergenic
1201011341 Y:9550049-9550071 ATTTCTACATGTATGAAAGGAGG - Intergenic
1201115180 Y:10829913-10829935 CTGTCGACATAAATGAATGGAGG - Intergenic