ID: 966305585

View in Genome Browser
Species Human (GRCh38)
Location 3:178530324-178530346
Sequence CGTCTCTCTTTATCACAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966305585_966305590 28 Left 966305585 3:178530324-178530346 CCTAATTGTGATAAAGAGAGACG 0: 1
1: 0
2: 0
3: 10
4: 174
Right 966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG 0: 1
1: 0
2: 0
3: 1
4: 15
966305585_966305589 19 Left 966305585 3:178530324-178530346 CCTAATTGTGATAAAGAGAGACG 0: 1
1: 0
2: 0
3: 10
4: 174
Right 966305589 3:178530366-178530388 CAAGAACATGACCCAAATCGTGG 0: 1
1: 0
2: 1
3: 5
4: 88
966305585_966305591 29 Left 966305585 3:178530324-178530346 CCTAATTGTGATAAAGAGAGACG 0: 1
1: 0
2: 0
3: 10
4: 174
Right 966305591 3:178530376-178530398 ACCCAAATCGTGGTCGTACTGGG 0: 1
1: 0
2: 0
3: 0
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966305585 Original CRISPR CGTCTCTCTTTATCACAATT AGG (reversed) Intronic
903561136 1:24228822-24228844 CATGTCTCTGTATCACATTTTGG - Intergenic
908340788 1:63176837-63176859 CATGTCTCTATATCACATTTTGG - Intergenic
908912778 1:69091696-69091718 CGTGTCATTTTATCAAAATTGGG + Intergenic
910782611 1:90956264-90956286 CGTATCTCCGTATCACATTTAGG - Intronic
911032477 1:93504545-93504567 CATACCTCTTTATCAGAATTTGG + Intronic
915855434 1:159379985-159380007 CATGTCTCTGTATCACATTTGGG - Intergenic
918877401 1:190065856-190065878 CGTGTCTCTGTGTCACATTTTGG - Intergenic
918978897 1:191528828-191528850 CGTGTCTCTGTATCACATTTTGG + Intergenic
919668380 1:200314989-200315011 CTTCTTTCTTTATCACATCTAGG - Intergenic
920894323 1:210029708-210029730 TGTTTCTCTTTTTCAGAATTGGG + Intronic
923000613 1:230003857-230003879 CGTCTCTCTTTCCCATGATTCGG + Intergenic
923717816 1:236440664-236440686 TGTGTCTCTGTGTCACAATTTGG + Intronic
1063180787 10:3597857-3597879 CCTGTCTATGTATCACAATTGGG + Intergenic
1063997327 10:11632187-11632209 TGTATCTTTTTATCAGAATTAGG - Intergenic
1065002425 10:21348902-21348924 ATTCTATCTTGATCACAATTTGG - Intergenic
1067548113 10:47211007-47211029 CGTGTCTCTGTGTCACATTTTGG + Intergenic
1068532122 10:58201343-58201365 CATTTCTCTGTATTACAATTTGG + Intronic
1069187533 10:65444054-65444076 TGTCTCTCTCTTTCACAATATGG - Intergenic
1070315422 10:75306713-75306735 CGTGTCTCTGTGTCACAATTTGG + Intergenic
1072485292 10:95848781-95848803 CATTTCTCTTTATCACAGATTGG - Intronic
1077648579 11:3949103-3949125 TGCTTCTCTGTATCACAATTTGG - Intronic
1080171054 11:29303375-29303397 CATGTCTCTTTGTCACATTTTGG + Intergenic
1080236970 11:30081304-30081326 CCTCTTTCTTTTTCACAACTTGG + Intergenic
1081091456 11:38871893-38871915 TGTCTCACATTATCACATTTTGG - Intergenic
1081234488 11:40630540-40630562 GTTCTCTCATTATCACTATTTGG + Intronic
1082215697 11:49565898-49565920 CGTCTCTCCTTAGCATTATTTGG + Intergenic
1085120500 11:73964549-73964571 CGTCTCTCTTATTCACAACTCGG - Intronic
1086633883 11:89058578-89058600 CGTCTCTCCTTAGCATTATTTGG - Intronic
1086810246 11:91300911-91300933 TGTCCCTCTTTATCACTATAAGG - Intergenic
1087657821 11:100946799-100946821 CGTGTCTCTGTATCACATTTTGG - Intronic
1088148027 11:106707522-106707544 TGTCTTACTTTATCACACTTTGG - Intronic
1091038476 11:132254945-132254967 CATTTTTGTTTATCACAATTGGG - Intronic
1093428412 12:19055313-19055335 AGTTTCTGTTGATCACAATTAGG + Intergenic
1093872108 12:24305296-24305318 CATCTCTCTTTGTTACACTTAGG - Intergenic
1095605997 12:44068742-44068764 TGTGTCTCTGTATCACATTTTGG - Intronic
1096412640 12:51388291-51388313 CCTCTCTCTCTTTCACAATCAGG + Intronic
1098075215 12:66722548-66722570 CGTGTCTCTCTGTCACATTTTGG - Intronic
1098382658 12:69885052-69885074 GTTCTCTCTTTCTCTCAATTTGG + Intronic
1098921832 12:76309708-76309730 CGTGTCTCTGTGTCACATTTTGG - Intergenic
1099726580 12:86437691-86437713 TGTGTCTCTTTGTCACACTTTGG + Intronic
1105392996 13:19999329-19999351 CGTGTCTCTGTTTCACATTTTGG + Intronic
1106444428 13:29813018-29813040 CGTAACTCTTAGTCACAATTGGG - Intronic
1109794770 13:67296646-67296668 CCTCTCACTTTATCCCACTTGGG + Intergenic
1110366465 13:74691892-74691914 CAACTTTCTTCATCACAATTAGG + Intergenic
1111243765 13:85508513-85508535 CATAGCTCTTTATCACAGTTAGG - Intergenic
1111640505 13:90963650-90963672 TGTGTCTCTGTATCACATTTTGG + Intergenic
1115468333 14:33740859-33740881 CCTCTCTCTTTCTGAAAATTAGG + Intronic
1116625887 14:47262826-47262848 TATCTCTCTTTATGAAAATTTGG + Intronic
1116687999 14:48067223-48067245 TGTGTCTCTGTATCACATTTAGG - Intergenic
1118159513 14:63274418-63274440 CAGCTCTCTTTTTCATAATTTGG - Intronic
1119961726 14:78865963-78865985 CCTTTCTCTTTATCAGAATCAGG + Intronic
1120050764 14:79862913-79862935 CTTTCCTCTTTAACACAATTTGG - Intronic
1124991689 15:34680592-34680614 TCTTTCTCTTTCTCACAATTGGG + Intergenic
1125000572 15:34765859-34765881 CGTGTCTCTATATTACATTTTGG - Intergenic
1125183825 15:36908416-36908438 TGTCTCTATTTCTCACAAATCGG - Intronic
1126809671 15:52388918-52388940 AGTCTGTCTTTATCCCAGTTAGG - Intronic
1129126449 15:73445891-73445913 CATGTCTCTGTATCACATTTTGG - Intronic
1134606618 16:15576375-15576397 CGTCCCTGCTTATCACAATCAGG - Intronic
1137740369 16:50765226-50765248 CGTGTCTCTGTGTCACATTTTGG + Intronic
1140162635 16:72513993-72514015 TGTCTCTCTGTGTCACATTTTGG - Intergenic
1148696169 17:49560157-49560179 TGTGTCTCTGTATCACATTTTGG + Intergenic
1151482401 17:74378112-74378134 TGACTTTCTTAATCACAATTGGG + Intergenic
1152970565 18:157817-157839 CGTGTCTCTGTGTCACATTTTGG - Intergenic
1152971875 18:169759-169781 CATGTCTCTTTGTCACATTTTGG + Intronic
1153823823 18:8856352-8856374 TGTCTTTGTTTATGACAATTGGG - Intergenic
1155266181 18:24096144-24096166 CGTGTCTCTGTGTCACATTTTGG - Intronic
1155686198 18:28554782-28554804 TGTGTCTCTTTGTCACAGTTTGG + Intergenic
1158816674 18:61106227-61106249 TGTGTCTCTGTATCACATTTTGG - Intergenic
1159514508 18:69440323-69440345 CCTGTCTCTTTGTCACATTTTGG - Intronic
1160246016 18:77160128-77160150 TGTCTTTATTAATCACAATTTGG - Intergenic
1160546504 18:79660406-79660428 CGTGTCTCTGTGTCACATTTTGG - Intergenic
925123803 2:1439531-1439553 GGGCTATTTTTATCACAATTGGG - Intronic
931013657 2:57949370-57949392 CTTTTCTCTGTATCACATTTTGG + Intronic
932286447 2:70537059-70537081 CGTGTCTCTGTGTCACATTTTGG + Intronic
932425340 2:71630652-71630674 TCTCACTCTTAATCACAATTTGG - Intronic
933414203 2:81965084-81965106 CTGTTCTCTTTATCACATTTTGG + Intergenic
933487433 2:82940364-82940386 TGTGTCTCTGCATCACAATTTGG - Intergenic
935878461 2:107536853-107536875 TGTCTCTTTTTATGAAAATTGGG + Intergenic
935990395 2:108714094-108714116 CATGTCTCTGTATCACATTTTGG - Intergenic
936225796 2:110649666-110649688 ATTCTATCTTTAACACAATTAGG + Intronic
936670993 2:114655895-114655917 CTTCTCTCTTTGACAGAATTAGG - Intronic
939207553 2:139127107-139127129 CATGTCTCTGTATCACATTTTGG + Intergenic
939704794 2:145439485-145439507 CGTGTCTCTGTGTCACATTTTGG - Intergenic
939755761 2:146107794-146107816 TGTCTCTCTTTATAAAAATCTGG + Intergenic
939839645 2:147171707-147171729 CCACTCTCTTTACCTCAATTTGG - Intergenic
940023999 2:149185771-149185793 TGTGTCTCTTCATCACATTTTGG + Intronic
941031106 2:160512577-160512599 GGTCTGTCTTTACCACAACTAGG + Intergenic
941530643 2:166666457-166666479 CTACTCTCATGATCACAATTTGG - Intergenic
941545448 2:166844712-166844734 CGTCATTCTTTATTACACTTTGG - Intergenic
942534114 2:176945338-176945360 GGTGTCTCTTTGTCACATTTTGG + Intergenic
943034477 2:182725049-182725071 CATGTCTCTTTCTCACATTTTGG + Intronic
943123442 2:183766885-183766907 TGTATCTCTGTATCACATTTTGG - Intergenic
944892618 2:204133401-204133423 TGTTTCTCTTTCGCACAATTAGG - Intergenic
1168782867 20:509502-509524 CTTCTCACGTTATCACAATCTGG - Intronic
1169090262 20:2856398-2856420 CATGTCTCTGTGTCACAATTTGG - Intronic
1170650458 20:18235360-18235382 CGTGTCTCTGTGTCACATTTTGG - Intergenic
1171295929 20:24017060-24017082 GCACTCTCTTTATCATAATTGGG - Intergenic
1171483742 20:25472215-25472237 CTTCTGTCTGTATCACATTTGGG - Intronic
1174722582 20:52829271-52829293 CATCTGTCTTTTTCACAGTTGGG - Intergenic
1178152391 21:29810368-29810390 TGTATCTCTGTATCACATTTCGG - Intronic
1179503826 21:41826568-41826590 AGTCTGTCTTGATCCCAATTTGG - Intronic
1182757406 22:32691001-32691023 GCTCTCTCTTCATCACATTTTGG - Intronic
951466555 3:23006238-23006260 CATCTCTCTTTGTCACCATTGGG - Intergenic
953138767 3:40208069-40208091 CATCTTTCTTTAGCATAATTGGG + Intronic
953445705 3:42963773-42963795 CATATCTCTGTATCACATTTTGG + Intronic
956586202 3:70867674-70867696 CGTCTCTCTCTCTCTCAACTGGG - Intergenic
956883428 3:73534388-73534410 CGTCTCTCTTTTTTTGAATTTGG + Intronic
959808641 3:110590368-110590390 GCTGTCTCTTTATCACAATATGG + Intergenic
961092134 3:124122534-124122556 CGTGTCTCTATGTCACATTTTGG + Intronic
963198607 3:142563384-142563406 CATGTCTCTGTATCACATTTTGG + Intronic
964599113 3:158475520-158475542 CATATCTCTTTGTCACATTTTGG + Intronic
966305585 3:178530324-178530346 CGTCTCTCTTTATCACAATTAGG - Intronic
969980919 4:11153328-11153350 TGTCTTTCTTTATGACACTTTGG - Intergenic
970414249 4:15840757-15840779 CGTCTCTATTGATCCCAAGTAGG + Intronic
970605396 4:17676451-17676473 CGTGTCTCTGTGTCACATTTTGG - Intronic
971164186 4:24165598-24165620 CATGTCTCTGTATCACATTTTGG + Intergenic
972906605 4:43756406-43756428 CGTGTCACTTTTACACAATTAGG - Intergenic
976128258 4:81856202-81856224 CTATTCTCTTTATCACTATTGGG - Intronic
977612906 4:99054990-99055012 CATGTCTCTGTGTCACAATTTGG - Intronic
978134441 4:105240160-105240182 CATGTCTCTGTATCACATTTTGG - Intronic
980513923 4:133828515-133828537 CATCTTTCTTTATTAAAATTAGG + Intergenic
980594730 4:134939033-134939055 CGTGTCTCTCTGTCACACTTCGG + Intergenic
981672412 4:147302041-147302063 CTTCTCTCTTTATCACCAAGAGG - Intergenic
982149384 4:152435821-152435843 CATGTCTCTGTATCACATTTTGG + Intronic
983549604 4:169002848-169002870 TGTGTCTCTTTGTCACATTTTGG + Intronic
984084364 4:175290303-175290325 CATGTCTCTGTATCACATTTTGG - Intergenic
986752794 5:10804514-10804536 TGTGTCTCTGTATCACATTTTGG + Intergenic
988669784 5:33369036-33369058 CATGTCTCTGTATCACATTTTGG - Intergenic
990887468 5:60611112-60611134 CATGTCTCTGTATCACATTTTGG + Intronic
991228608 5:64303018-64303040 TGTGTCTCTTTGTCACATTTTGG + Intronic
991943624 5:71879290-71879312 CCTCTCTCTTTATCTCACTATGG + Intergenic
995339590 5:111042936-111042958 TGTGTCTCTGTATCACAGTTTGG - Intergenic
996235242 5:121120395-121120417 CATCTTTCTGTATCCCAATTAGG + Intergenic
999687995 5:154119397-154119419 CGTGTCTCTGTGTCACATTTTGG + Intronic
1001230332 5:169981465-169981487 CGTATCTCTGCATCACAATTCGG + Intronic
1001712019 5:173786627-173786649 TGTCTCTCCTTTTCACACTTAGG + Intergenic
1004978609 6:20996705-20996727 CGTATCTCTGTGTCACATTTTGG - Intronic
1005469545 6:26148865-26148887 AGACTCTCTATATCACAGTTTGG + Intergenic
1007650895 6:43420807-43420829 CGTGTTTCTGTATCACATTTTGG + Intergenic
1009286942 6:61830482-61830504 CATCTCTCTTTATCACATTAGGG - Intronic
1010382700 6:75243125-75243147 CATTTTTCTTTATCAAAATTTGG + Intronic
1010697317 6:78992561-78992583 CGTGTCTCTGTGTCACATTTTGG + Intronic
1010767540 6:79793276-79793298 AGTCTCTCTGTATGGCAATTTGG - Intergenic
1011366531 6:86588137-86588159 AGTCTCTCTTTATAAAAATCTGG - Intergenic
1012937428 6:105382994-105383016 CCTCTCACTTTAGCAGAATTTGG + Intronic
1012975747 6:105779266-105779288 CGTCTGTTTTTATCACAGCTTGG - Intergenic
1013261293 6:108445877-108445899 TGTGTCTCTGTATCACATTTTGG - Intronic
1014294217 6:119598637-119598659 TGTGTCTCTGTATCACATTTTGG - Intergenic
1016257143 6:142121017-142121039 TGTGTCTCTGTATCACATTTTGG + Intergenic
1020459654 7:8414334-8414356 CGTGTCTCTGTTTCACATTTTGG + Intergenic
1020580771 7:9997558-9997580 TGTCTATATTTATCACAATACGG - Intergenic
1023514807 7:40991428-40991450 CGTGTCTCTGTGTCACATTTTGG - Intergenic
1024755814 7:52529629-52529651 CGTCTCAGGTTATCACAACTAGG - Intergenic
1027511387 7:79086106-79086128 TGTCTCTCATTATCTCTATTTGG + Intronic
1027945017 7:84733539-84733561 GGTGTCTCTTTGTCACATTTTGG - Intergenic
1028068211 7:86414700-86414722 CATCTCTCTTTCTGACAACTAGG + Intergenic
1028296674 7:89141263-89141285 CTTCTCTCTCTGTCACATTTTGG - Intronic
1029674151 7:102055414-102055436 CCTTTCTCTTTGTCACACTTTGG + Intronic
1032177240 7:129640785-129640807 GGTCTTTCTTGGTCACAATTTGG + Intronic
1032180899 7:129676688-129676710 CGTGTCTCTGTGTCACATTTTGG - Intronic
1032665701 7:134034143-134034165 TGTATCTCATTATCCCAATTTGG - Intronic
1037218560 8:16488148-16488170 TGTGTCTCTTTGTCACATTTTGG - Intronic
1042061945 8:64828107-64828129 CATTTCTCTTTAGCAAAATTAGG + Intergenic
1046233872 8:111395109-111395131 CCCCTCTTTTTATCACAATTAGG - Intergenic
1052442380 9:28513972-28513994 CCTGTCTCTTTGTCACATTTTGG + Intronic
1053410883 9:37915389-37915411 CCTCTCTCTTCCTCATAATTAGG + Intronic
1055041319 9:71876509-71876531 TGTCTCTTTTTAGCAAAATTAGG + Intronic
1055760451 9:79601488-79601510 CGTGTCTCTGTGTCACATTTTGG + Intronic
1055852567 9:80649914-80649936 AGTCTCTCTTTATCTAAGTTTGG + Intergenic
1187539594 X:20179124-20179146 CTTCTCTCTTTTGCATAATTAGG - Intronic
1187662966 X:21571275-21571297 CGTGTCTCTGTATCATATTTTGG - Intronic
1188093020 X:25986988-25987010 CATCTCTCTCTGTCACACTTTGG + Intergenic
1188221907 X:27550908-27550930 CGTGTCTCTGTGTCACATTTTGG + Intergenic
1188291457 X:28393819-28393841 CGTGTCTCTGTGTCACATTTAGG - Intergenic
1189787889 X:44576071-44576093 CATGTCTCTTTGTCACATTTTGG + Intergenic
1190573655 X:51811324-51811346 CATCTCTCTTTATTACCAATTGG + Intronic
1190714997 X:53095556-53095578 CTACTCTCTATATTACAATTAGG - Intergenic
1191175893 X:57501658-57501680 CATCTCTTTTTATCAAAATTGGG - Intergenic
1192549040 X:72039153-72039175 TGTCTCTCTTTATTTCAATTAGG + Intergenic
1193325141 X:80171764-80171786 CTTCTCTCTTCATCCCACTTTGG - Intergenic
1193396141 X:80985876-80985898 CGTGTCTCTGTATCACATTCTGG - Intergenic
1194940204 X:99999983-100000005 CATGTCTCTGTATCACATTTTGG + Intergenic
1198304490 X:135367336-135367358 TGTGTCTCTTTGTCACATTTTGG + Intergenic
1200013755 X:153142405-153142427 CGTGTCTCTGTGTCACATTTTGG + Intergenic
1200025846 X:153257550-153257572 CGTGTCTCTGTGTCACATTTTGG - Intergenic