ID: 966305590

View in Genome Browser
Species Human (GRCh38)
Location 3:178530375-178530397
Sequence GACCCAAATCGTGGTCGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 15}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966305585_966305590 28 Left 966305585 3:178530324-178530346 CCTAATTGTGATAAAGAGAGACG 0: 1
1: 0
2: 0
3: 10
4: 174
Right 966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG 0: 1
1: 0
2: 0
3: 1
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966305590 Original CRISPR GACCCAAATCGTGGTCGTAC TGG Intronic
906217731 1:44053578-44053600 GGCCCAACTCCTGGTAGTACTGG - Intergenic
906719712 1:47996615-47996637 GACCCAAACCATGGTCCCACGGG + Intronic
1092790918 12:12070261-12070283 GATCCAAATCGTGCTCTTTCTGG - Intronic
1116239537 14:42323423-42323445 GGCCCCAATCCTGGTGGTACTGG + Intergenic
1118923131 14:70168039-70168061 GACCCGAATAGTGGTTGTGCTGG + Exonic
1147225395 17:38972794-38972816 CACCCAAATCTAGGTGGTACTGG + Intergenic
961909788 3:130302535-130302557 GACCCCATTCCTGGTGGTACTGG - Intergenic
966305590 3:178530375-178530397 GACCCAAATCGTGGTCGTACTGG + Intronic
996248559 5:121297229-121297251 GACCCGCATCGTGGTCTTAGGGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1002079590 5:176729426-176729448 GACCCAAAACATGGTTTTACTGG + Intergenic
1013641509 6:112087410-112087432 GACCCAGTCGGTGGTCGTACAGG - Exonic
1014303142 6:119708507-119708529 GACCCAAATGGTGGTCCATCAGG + Intergenic
1014687999 6:124527797-124527819 GACCCAAATTTGGGTCATACAGG + Intronic
1032085226 7:128880230-128880252 GCACCACATCGTGGTCGCACTGG + Intronic
1042632721 8:70837651-70837673 TAGCCAAATCTTGGTCGTGCTGG + Intergenic
1198928018 X:141821560-141821582 GGCCCAAATCCTGGTGGTACTGG + Intergenic