ID: 966306117

View in Genome Browser
Species Human (GRCh38)
Location 3:178536806-178536828
Sequence AGTGAGAAGCAGCAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 746}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966306117 Original CRISPR AGTGAGAAGCAGCAAGAGGA GGG Intronic
900362242 1:2294715-2294737 TGTGAGAAGCAGCTAGCGGGGGG - Intronic
900745391 1:4357216-4357238 AGTGAGAAAGAGAAAGAGAATGG + Intergenic
900799835 1:4730446-4730468 AATGAGAGGGATCAAGAGGAAGG - Intronic
900926487 1:5709420-5709442 GGCAAGAAGCAGCAAGAGAAGGG - Intergenic
901310742 1:8267645-8267667 AGTGAGAAGGAGCTAGTGGGAGG + Intergenic
902075653 1:13782779-13782801 AGTGAGAACAAGAGAGAGGACGG + Exonic
902343185 1:15797951-15797973 AGTGCCAAGTAGGAAGAGGATGG + Intergenic
903274182 1:22210400-22210422 AGTCAGAAGCAGCAACAGAAGGG - Intergenic
903553935 1:24179798-24179820 AGGGGAAAGCAGGAAGAGGAGGG - Intronic
904096038 1:27978154-27978176 AGTGACAGGGAGGAAGAGGAAGG + Intronic
904120322 1:28193924-28193946 AATGAGCAGCAGCAGGATGAAGG + Intronic
904774208 1:32896702-32896724 AGTGAGGAACATCAGGAGGAAGG - Intronic
904874351 1:33642851-33642873 AGTGAGAAGCAGAAACAGTTTGG - Intronic
904991773 1:34598931-34598953 ACAGAGGAACAGCAAGAGGAGGG - Intergenic
905500356 1:38431773-38431795 AGTCAGAAAGAGCAGGAGGAAGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905735504 1:40322928-40322950 AGTGATAGGCAGTAAGAGAATGG + Intergenic
905930459 1:41783258-41783280 AGTGAGAAGCCACAGGAGGAAGG + Intronic
906124442 1:43418835-43418857 AAAGAGCAGCAGCAGGAGGAGGG + Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906392507 1:45431120-45431142 AGTAAGAAGATGCAAGAGGCCGG + Intronic
906646480 1:47478844-47478866 AGAGAGGAGGAGCAAGAGGAGGG - Intergenic
906935787 1:50212960-50212982 ACTGTGAGGCAGGAAGAGGAAGG - Intergenic
906951056 1:50334773-50334795 AGTGAATGGCTGCAAGAGGAGGG - Intergenic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
907517813 1:55004382-55004404 AGTGAGAATCTGGCAGAGGAGGG + Intronic
907957840 1:59247943-59247965 ACTGAGAAGCAGCAAGCTCATGG - Intergenic
908267543 1:62394145-62394167 CCTGGGAAGCAGCAAGAGGAGGG - Intergenic
908308170 1:62846831-62846853 ATTGAGAACCAGCTAGAGGCAGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
910039699 1:82834869-82834891 AGTGAGAAGCAGGAAGAAGAAGG - Intergenic
910217057 1:84853514-84853536 AGAGAGAAGAAGCAGGAAGAGGG - Intronic
911566988 1:99473960-99473982 AGTGAGAACCACGAACAGGATGG - Intergenic
912280917 1:108312472-108312494 AGAGAAAAGTAGGAAGAGGATGG + Intergenic
913296378 1:117324682-117324704 GAAGAGAAGGAGCAAGAGGAGGG - Intergenic
914923727 1:151865375-151865397 AGGGAGTTGCAGCAGGAGGAAGG - Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916578737 1:166089410-166089432 AGCGACAAGGGGCAAGAGGATGG + Intronic
917143521 1:171862806-171862828 AAAGAGAAGCAGCAACAGAAGGG + Intronic
917245300 1:172994725-172994747 AGTGAGAGAGAGCAAGAGAAAGG - Intergenic
917392569 1:174554993-174555015 AGTTAGAATAAGCAAAAGGATGG + Intronic
917585115 1:176417984-176418006 AGTGAGAAAGAGAAAGAGGGGGG + Intergenic
918068916 1:181120833-181120855 AGAGAGTAGGAGCAAGAGAAAGG - Intergenic
918703575 1:187635477-187635499 AGTGACAGGGAGAAAGAGGATGG - Intergenic
918726288 1:187928600-187928622 AGAGAGAAGAAACAAGGGGAGGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919513140 1:198491159-198491181 AGAGAGCAGCAGGAAGAAGATGG + Intergenic
919780190 1:201216419-201216441 AGAGAGGAGCGGGAAGAGGAGGG - Intronic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
919869888 1:201812365-201812387 AGTGAGAAGCAGGCAGAAGGAGG + Intronic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920958843 1:210645956-210645978 AGGGTGAAGCAGCAACAGGGAGG - Intronic
920965632 1:210698521-210698543 AATAAGAAACAGCAAGAGAAAGG + Intronic
921409152 1:214815841-214815863 AGTGAAAAGAAGCAAGAGTGAGG - Intergenic
921422726 1:214967107-214967129 AGAGAGGGGTAGCAAGAGGAAGG + Intergenic
921533250 1:216311443-216311465 AATGAGAAACACCAAGTGGATGG - Intronic
921939568 1:220826271-220826293 AGTCAGGAGCTGCAAGAGGTCGG - Intergenic
922466581 1:225848963-225848985 GGTGAGCAGCAGCACCAGGAAGG + Exonic
923127049 1:231041163-231041185 AGTGGGAGGCAGCAGGAGGCGGG - Intergenic
923272326 1:232368920-232368942 AAAGAGGAGGAGCAAGAGGAAGG - Intergenic
923286583 1:232501914-232501936 AGGGAGAAGCAGCCGAAGGAAGG - Intronic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923753626 1:236770355-236770377 ACTGACATCCAGCAAGAGGAGGG - Intergenic
923852511 1:237812844-237812866 CGAGAAAAGCAGCAAAAGGAAGG - Intronic
924562041 1:245165092-245165114 TGTGAGAATGAGCAAGAAGATGG + Intronic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1062922329 10:1289627-1289649 AGTGAGAGGAAGCAGGAGGTGGG - Intronic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063265499 10:4444914-4444936 AGAGAGAACAAGCAAGAGCAGGG - Intergenic
1063614809 10:7592491-7592513 AGAGAGAAACAGAAAGAGTAGGG + Intronic
1063800416 10:9570989-9571011 AGTGTGAAGTAGGAAGAAGAAGG - Intergenic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1064464945 10:15569548-15569570 AGTAAGAAGCAGACAGAGGATGG - Intronic
1064735588 10:18378873-18378895 AGTTGGGAGCAGAAAGAGGAAGG - Intronic
1064955615 10:20905440-20905462 AGAGAGAGCCAGCAAGAGCAGGG + Intronic
1065316866 10:24472175-24472197 GGTGAGAAGGAGGAAGAGAAGGG + Intronic
1066192588 10:33069520-33069542 AGAGAGAAGGAGAGAGAGGAAGG - Intergenic
1066295748 10:34052807-34052829 CGGGAGAAGGAGCAAGAGGGTGG - Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067394997 10:45907019-45907041 AGTGAGAAGGAGCATGGAGATGG - Intergenic
1067408829 10:46047169-46047191 TGTAAGAGGCAGCAAGAGCATGG - Intergenic
1067557436 10:47282682-47282704 AGTGAGCAGCAGCATGAGCTTGG + Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067843642 10:49701599-49701621 AGGAGGAAGCAGCACGAGGAAGG - Intronic
1067863317 10:49876150-49876172 AGTGAGAAGGAGCATGGAGATGG - Intronic
1069053722 10:63821795-63821817 TGTGAGAAGCAGAAAGAGGCAGG - Intergenic
1069633398 10:69911191-69911213 ATTGAGAAGGGGCAAGGGGAAGG - Intronic
1069709059 10:70477848-70477870 AGTGTGGAGCAGCGAGAGGGAGG + Intergenic
1070542969 10:77430363-77430385 AGTGGGAAGGAGCAAAAAGAGGG - Intronic
1070744565 10:78925481-78925503 AGGGAGAAGGAGAAAAAGGAGGG + Intergenic
1071424158 10:85531730-85531752 AGAGAGAATCAGCAAAAGTAGGG + Intergenic
1071727312 10:88212296-88212318 AGTAGGAAGTACCAAGAGGAGGG - Intergenic
1072076586 10:91980846-91980868 ATTGATAAACAGCAAGATGAGGG - Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072318761 10:94228558-94228580 AGTGAGAACCCTCATGAGGATGG - Intronic
1072323668 10:94275182-94275204 AATGAGAAGGAGGAAAAGGAAGG - Intronic
1072494801 10:95946303-95946325 AGTGCTAAGAAGCTAGAGGAGGG - Intergenic
1073043680 10:100623832-100623854 AGAGAGAAGAGGCAGGAGGAAGG + Intergenic
1073148833 10:101298119-101298141 AGTGTGAAGCAGCTGGAGGGAGG + Intergenic
1074866766 10:117548505-117548527 AGAGAGAAGGAGAAAGAGGGAGG + Exonic
1075387180 10:122063356-122063378 AGTCAGAAGCAGGACAAGGAGGG - Intronic
1075427605 10:122353957-122353979 TGAGAGAGGGAGCAAGAGGAAGG - Intergenic
1075656143 10:124162464-124162486 AGTGGGCAGCAAGAAGAGGAAGG + Intergenic
1076076946 10:127541185-127541207 AGTGACAAGCTGGAAGAGGTTGG - Intergenic
1076456774 10:130605337-130605359 AGAGAGAAGCAGCTTGGGGAGGG + Intergenic
1077032343 11:474230-474252 AGGCAGAAGCAGGAAGAGAAGGG - Intronic
1077044117 11:536954-536976 AGTGAGAAGCGGCGACTGGACGG + Intronic
1077073226 11:687333-687355 AGCGAGAAGAAGCAGGAGGGAGG - Intronic
1077538213 11:3134516-3134538 AGGGACCAGCAGCAGGAGGAGGG - Intronic
1077693432 11:4370466-4370488 AGAGAAAAGGAGCAGGAGGAAGG - Intergenic
1077928725 11:6708543-6708565 AGAGAGAGGAAGCAAGAAGAAGG - Intergenic
1078475955 11:11630351-11630373 AGTGGGAAGAGGCAAGAGGAAGG - Intergenic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079535931 11:21515428-21515450 AGTGGCAGGTAGCAAGAGGAAGG - Intronic
1079687070 11:23372808-23372830 AATGAGAAGAAGAAAGAGAAGGG + Intergenic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1079816206 11:25062108-25062130 AGGGAGAAGAAGAAAAAGGAGGG + Intronic
1081028836 11:38051676-38051698 AGAGAGAGCCAGCAAGAGCAGGG + Intergenic
1081578538 11:44334879-44334901 AGAGAGAAGCTTCAAGAGGACGG - Intergenic
1081692158 11:45086028-45086050 GGTAAAAAGCAGCAAGGGGAGGG - Intergenic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1082877362 11:58001849-58001871 AGTAAGAAGCAGTAAGAGACAGG - Intergenic
1083047407 11:59749265-59749287 AGTGATGAGCAGGAAGGGGACGG - Intronic
1083052281 11:59788004-59788026 CGTGGGAAGCAGGAGGAGGATGG - Intronic
1083888114 11:65582498-65582520 AGAAAGAAGCAGCAAGATCAAGG + Exonic
1083944869 11:65918183-65918205 GGTGAGGAGCTGGAAGAGGAGGG - Exonic
1084180205 11:67442331-67442353 TGTGAGAAACGGCAAGATGAGGG + Intronic
1084253402 11:67921067-67921089 AGTGACAGGGGGCAAGAGGACGG - Intergenic
1084372135 11:68751233-68751255 GGTGAGGAGCAGCCAGGGGAGGG + Intronic
1084675809 11:70633717-70633739 GGTGAGGAGCTTCAAGAGGAAGG + Intronic
1085050417 11:73377314-73377336 AGTAAGAGGCAGGAGGAGGAGGG + Intronic
1085075974 11:73592625-73592647 AATGGGGAGAAGCAAGAGGAGGG + Intronic
1085235159 11:75008974-75008996 AGGGGGAAGAAGTAAGAGGAGGG - Exonic
1085822670 11:79809833-79809855 AGTATGAAGCAGAAAGAGGCAGG + Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085867516 11:80312053-80312075 AATGAGCAGAAGCAAGAGGATGG - Intergenic
1086096478 11:83054920-83054942 CCTCAGAAGCAGCAAGAAGATGG + Intronic
1086280671 11:85183814-85183836 AGTGAGAAGCAAGAAACGGATGG - Intronic
1086575759 11:88337622-88337644 GGAGAGAAGCAGCAGGAGGGCGG + Exonic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086872850 11:92060251-92060273 CGTGAGATGCAGCAAAGGGAAGG - Intergenic
1086923391 11:92613261-92613283 AATGAGGAGAAGCAAGAGGCTGG - Intronic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087512550 11:99115827-99115849 AGTGAGAAGCAAAGAAAGGAAGG + Intronic
1087740936 11:101886092-101886114 GGTTAGAAGCAGCCAGAGCAGGG + Intergenic
1087906508 11:103703823-103703845 AGTGAGAAGCAGCAGTGTGATGG + Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088445307 11:109920519-109920541 AGTAATAAGCAGCTAGAGCAAGG - Intergenic
1088700975 11:112411371-112411393 AGTGGGAACCAGCAAGATAAAGG + Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089695889 11:120216123-120216145 AGTGAGTGGGAGCCAGAGGAAGG + Intronic
1089858021 11:121564224-121564246 AGAGAGAAGCTGGAAGAAGATGG - Intronic
1089981007 11:122772499-122772521 AGAGGGAAGGAGGAAGAGGAGGG + Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090339086 11:125999658-125999680 AATGAGAAGGAGAAAGATGATGG - Intronic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1090422694 11:126586479-126586501 AATGACAAGCAGAAAGAGGGCGG - Intronic
1090685648 11:129115592-129115614 AGTGAGCATCAGTAAGATGAGGG - Intronic
1090785168 11:130042262-130042284 AGTGAAAATAAGCACGAGGAAGG + Intergenic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091205650 11:133819071-133819093 AGACAGGTGCAGCAAGAGGAGGG - Intergenic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1093007460 12:14065770-14065792 AGAGAGAAGCAGAAAGAGTTAGG - Intergenic
1093206822 12:16261223-16261245 AATGAGAAGGGGTAAGAGGAAGG - Intronic
1093704343 12:22258014-22258036 AGTGAGAAGCAGCCAGATTCTGG - Intronic
1093704351 12:22258060-22258082 AGTGAGAAGTAGCCAGAAGCTGG + Intronic
1093743609 12:22715139-22715161 AGTAAGAAGGAGAAAGAGGGAGG - Intergenic
1094236870 12:28177989-28178011 AGAGAGAATGAGCAAGAGCAGGG - Intronic
1094717232 12:33024678-33024700 TGAGAGAGGGAGCAAGAGGAAGG - Intergenic
1095154971 12:38841857-38841879 AGGGAGAAGCAGAAAGATGAAGG + Intronic
1095290377 12:40472817-40472839 AGGGAGGAGGAGGAAGAGGAGGG - Intronic
1095528611 12:43158024-43158046 TGAGAAAAGCAGCAAGAGGATGG + Intergenic
1095714151 12:45323416-45323438 AGAGAGAAGAAGCAAGATGCAGG + Intronic
1096046036 12:48563246-48563268 AGGGAGAGGCAGGAAGAAGAGGG - Intergenic
1096196882 12:49654319-49654341 CCAGAGAAGCAGCAACAGGAAGG + Intronic
1096254941 12:50057265-50057287 AGGAAGCAGCAGCAAGAGGCAGG + Intergenic
1096256114 12:50063333-50063355 GCTGAGCAGCAGCAAGGGGAGGG + Intronic
1096405382 12:51340237-51340259 AGTGAAAAGAAGCAGGAGTAGGG - Intronic
1096571985 12:52528804-52528826 GGAGAGAAGCAGGGAGAGGAGGG - Intergenic
1096682164 12:53263188-53263210 AATGAGGAGGAGGAAGAGGAAGG + Intergenic
1097158907 12:57031866-57031888 AGAGAGAAGGAGGAAGAGCATGG - Intronic
1097159377 12:57035580-57035602 AGAGAGAAGGAGGAAGAGCATGG - Intronic
1098726108 12:73969825-73969847 AGTAAGAAGGAGGAAGAAGAGGG + Intergenic
1098788843 12:74794429-74794451 AGTAAGAATAAGGAAGAGGAAGG - Intergenic
1100245101 12:92749813-92749835 AGTGGGATGCAGCATTAGGATGG - Intronic
1100257545 12:92899751-92899773 AATGAGAACGAGCAAGAGGAAGG - Intronic
1100466554 12:94850657-94850679 AGAGAGAGGAAGCAAGAGGGAGG + Intergenic
1100559885 12:95737580-95737602 AGTGAGCAGGAGTGAGAGGATGG - Intronic
1100700243 12:97139669-97139691 AGTGAGTAGCAGGAAGATGAAGG - Intergenic
1100997483 12:100318250-100318272 AGAAAGAAGCAGAAAGATGAAGG - Intronic
1101308223 12:103552893-103552915 AGAGAGAACAAGCAAGAGCAGGG + Intergenic
1101408750 12:104452417-104452439 ACTGAGGAGCAGCAAGAGGCAGG + Intergenic
1101794110 12:107957040-107957062 AATGAGAAGAAGAAAGAAGAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102394517 12:112575024-112575046 AGGGAGAGGGAGGAAGAGGAGGG + Intronic
1102569862 12:113820855-113820877 AGTGAAAGGTAGCAAGAGGAGGG - Intronic
1102732378 12:115123824-115123846 ACTGAGTAGCAGCGAGATGAAGG - Intergenic
1102833322 12:116028316-116028338 AGTGACAAGAAGCAAGAACATGG - Intronic
1102925809 12:116825270-116825292 AGGGAGAACAAGCAAAAGGAAGG + Intronic
1103680663 12:122690966-122690988 AATAACAAGCAGAAAGAGGAAGG - Intergenic
1103952954 12:124561576-124561598 AGTGAGATGTGGGAAGAGGAGGG + Intronic
1104091948 12:125525028-125525050 AATGAGTAGGAGCAAGAGCATGG + Intronic
1104953221 12:132451634-132451656 AGTGAGGAGCAGCCACAGGAAGG + Intergenic
1105008634 12:132739116-132739138 AGTGAGGAGGAGGGAGAGGATGG + Intronic
1105572944 13:21621179-21621201 AGAGAGAAGAAGCAAGTGGTAGG - Intergenic
1105955909 13:25282464-25282486 AGGAGGAAGCAGCCAGAGGATGG + Intronic
1106130402 13:26934706-26934728 AGAGAGAGGCAGCAAGAGGAAGG - Intergenic
1106288656 13:28340598-28340620 AGGGAAAAGCACCAAAAGGAAGG - Intronic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1106545812 13:30730547-30730569 AGGGAGAAGGAGCAGGAGGTGGG - Intronic
1106578389 13:30997206-30997228 AGTTAGAAGGAGCATGAGGTTGG + Intergenic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107250693 13:38357846-38357868 ACTGAGGAGAAGGAAGAGGAAGG + Intronic
1107350743 13:39512169-39512191 AGTGTTAAGCAGGAAGAAGAAGG - Intronic
1107817340 13:44255949-44255971 AGTGAGAGGAAGTAACAGGATGG - Intergenic
1107999429 13:45892724-45892746 AGAAAGAAGCAACAGGAGGAAGG + Intergenic
1108392090 13:49956508-49956530 AGAAAGAAGAAGAAAGAGGAAGG - Intergenic
1108546215 13:51497334-51497356 AGTGAGGAGGAGCAAGGAGAGGG - Intergenic
1108800783 13:54092444-54092466 AGTGAGGAGTAGCAGGAGCAGGG + Intergenic
1108809287 13:54201503-54201525 AAGGAACAGCAGCAAGAGGATGG - Intergenic
1108996678 13:56743193-56743215 TGTGAGAAGTGGAAAGAGGATGG - Intergenic
1109428124 13:62194503-62194525 AGTGAGAAGGACATAGAGGATGG - Intergenic
1110386790 13:74921484-74921506 AGAAAGAAGCACCAAGATGAAGG + Intergenic
1112972123 13:105273579-105273601 AGTGAGAAGTAGCAGGGGAAAGG + Intergenic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113251526 13:108458425-108458447 AGTGAGAAAGAGAAAGAGTAGGG - Intergenic
1114197986 14:20495714-20495736 AGGGAGAGGAAGGAAGAGGAGGG - Intergenic
1114522671 14:23348729-23348751 AGAGAGAAGAAGAAAGAGGGAGG + Intronic
1116253432 14:42517483-42517505 AGGCAGAAGGTGCAAGAGGAAGG + Intergenic
1116727798 14:48584199-48584221 AGTGGGAAGTAGAAACAGGATGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117328437 14:54689775-54689797 ACTGAGTAGAGGCAAGAGGAGGG + Intronic
1117479215 14:56126389-56126411 AGTGAGAAGCATTATGCGGATGG - Intronic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118180134 14:63484103-63484125 AGTTAGAAGCAGAAAGATAAAGG + Intronic
1118229028 14:63930491-63930513 AGTGATGAGCAGCCAGATGAAGG - Intronic
1118280116 14:64420640-64420662 AGTGGGAAGCAGCTGGAGGGAGG - Intronic
1118294676 14:64558193-64558215 GGTGAGAAGCAGCTTCAGGAAGG + Intronic
1118660771 14:68008219-68008241 ATTTATAATCAGCAAGAGGATGG + Intronic
1118852353 14:69593638-69593660 AGTGTGAAGCTGGAAGAGGCAGG - Intergenic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1119383970 14:74245765-74245787 GGTGGGAAGCAGGAAGAGAAGGG - Intronic
1119483955 14:74976297-74976319 AGAGAGGAGGAGCAAGGGGAAGG - Intergenic
1120269770 14:82296542-82296564 AGAGACAAGAAGCAAGAGCAGGG + Intergenic
1120722672 14:87905463-87905485 AGTGGGAACCAGAAAGAGAAAGG - Intronic
1120823481 14:88934235-88934257 TTTGAGAAGCAGCAAGCGGTGGG - Intergenic
1121140601 14:91538547-91538569 AGAGAACAGCACCAAGAGGATGG + Intergenic
1121550097 14:94792834-94792856 AGAGAGAAAGAGAAAGAGGAAGG + Intergenic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1123683902 15:22783944-22783966 AGTGAGAAACACTAAGAGGGTGG - Intronic
1123723847 15:23083253-23083275 AGTAAGAACCATCAACAGGAAGG + Intergenic
1125253630 15:37736192-37736214 AGTGAGTAGAAGCAGGAGCAAGG - Intergenic
1125542022 15:40475085-40475107 AGAGAGAAGAAGGAATAGGAAGG + Intergenic
1126484975 15:49170137-49170159 AGGGAGGAGGAGCCAGAGGAGGG + Exonic
1127136689 15:55931316-55931338 AGTGGGTAGCAGGAATAGGAGGG + Intronic
1128304173 15:66587076-66587098 GGGGAGAAGGAGGAAGAGGAAGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128400148 15:67270629-67270651 TGAGAGAAGCAGCAAGAGAGAGG - Intronic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1128869012 15:71138228-71138250 AGAGAGAACAAGCAAGAGCAGGG + Intronic
1129698479 15:77754178-77754200 AGGGAGCAGGAGCAAGAGGATGG + Intronic
1130056820 15:80533293-80533315 AGTGTGGAGCAGGAAGTGGAAGG + Intronic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1131620441 15:94062476-94062498 AGTGAGAAGTAGAAAGGGAAAGG + Intergenic
1131727168 15:95239359-95239381 AGAGAAAAGGAGAAAGAGGAAGG + Intergenic
1132060489 15:98688323-98688345 AGTGAAAGGCAGAGAGAGGAGGG - Intronic
1132281212 15:100617489-100617511 AGAGAGAAGCAGGCAGAGCAAGG - Intronic
1132814120 16:1817820-1817842 GCCGCGAAGCAGCAAGAGGAGGG - Intronic
1132823557 16:1890601-1890623 TGTGAGCAGCAGAAAGCGGATGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133516323 16:6512760-6512782 AGTCAGCAGGAGCAAGAGGATGG + Intronic
1133571947 16:7049691-7049713 ATTAAAAAGCAGCAAGTGGAGGG - Intronic
1133644888 16:7754784-7754806 GGTGAGAGGGAGCAAGAGGCGGG + Intergenic
1133840515 16:9404090-9404112 AGTCAGAATCAGCAAAAAGATGG - Intergenic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1134008947 16:10836925-10836947 ACAGAGAAGAAGCAAGAGTAGGG - Intergenic
1135066537 16:19314898-19314920 AGGGAGAAGAAGGGAGAGGAAGG + Intronic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135414188 16:22256676-22256698 TCTGAGAAGCGGCAAGGGGAGGG - Intronic
1135795382 16:25436408-25436430 AGTGATGAGGAGGAAGAGGATGG - Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137257265 16:46786613-46786635 ATTTTGAAGCAGCAAGAGAAAGG + Intronic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1137936532 16:52640232-52640254 TGTGAGAAGAAGGAAGAGGGAGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1138633797 16:58320400-58320422 AGAGAGGAAAAGCAAGAGGAGGG + Intronic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139760354 16:69180086-69180108 AGGGAAAAGAAGAAAGAGGAAGG - Intronic
1141009419 16:80383650-80383672 AGTGAGAGCGAGCAAGAGCAGGG + Intergenic
1141202415 16:81908230-81908252 AGTGGGAGGCAGGCAGAGGAGGG + Intronic
1141514594 16:84535193-84535215 AAGGAGAAGGAGGAAGAGGAGGG - Intronic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1142944512 17:3413189-3413211 GGAGAGAAGCAGCAGGAGGGAGG + Intergenic
1143015946 17:3891365-3891387 AGTAAGAAGGATCAAGAGAAAGG + Intronic
1143391314 17:6560892-6560914 GATGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391364 17:6561092-6561114 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143391516 17:6561609-6561631 AGAGGGAAGGAGGAAGAGGAGGG - Intergenic
1143563880 17:7709930-7709952 AGTGAGAGGCAGAAAGAAGGCGG - Exonic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1144160250 17:12550960-12550982 TGTATGAAGCACCAAGAGGAAGG + Intergenic
1144202398 17:12953289-12953311 AGTGTGAAGCAGCAGGAGCCAGG - Intronic
1144886834 17:18468855-18468877 AGCGAGAAGCAACAAGAGTTGGG + Intergenic
1145834913 17:27947268-27947290 AGTGAGAGGGGGCAGGAGGAGGG + Intergenic
1146126022 17:30232401-30232423 AGTGACAGACAGCAAGGGGAGGG - Intronic
1146615937 17:34357489-34357511 AATGTGAAGCAGCAAGTAGATGG - Exonic
1146936369 17:36814869-36814891 AGAGAGAATGAGAAAGAGGAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1147396898 17:40150629-40150651 AGTTAGAAGCATCAAGGGAATGG + Intronic
1148090731 17:45021197-45021219 GGAGAGAAGGAGCAAAAGGAAGG - Intergenic
1148493499 17:48037892-48037914 GGGGAGAACGAGCAAGAGGACGG - Intronic
1149964061 17:61143932-61143954 AGTGTGAAGCACCAAGTAGATGG + Intronic
1151082820 17:71347694-71347716 TGTGAGAGACAGCAACAGGAGGG - Intergenic
1151138350 17:71968922-71968944 TGTGAGACACAGCAAGAAGATGG + Intergenic
1152266282 17:79296846-79296868 AGGGAGGAGAAGCAGGAGGAGGG - Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152474771 17:80510791-80510813 AGTGAGGAGCAGCATGGGGTTGG + Intergenic
1152502397 17:80721112-80721134 AGTGAGAACCAGCTAGACAAGGG + Intronic
1153165607 18:2258370-2258392 AGAGAGAAAGAGCAAGAGCAAGG + Intergenic
1153230261 18:2928244-2928266 GGGAAGAAGCAGCAAGAAGAAGG - Intronic
1153463276 18:5361180-5361202 AGGGAGAAGAAGCAGGAGTATGG + Intergenic
1153521002 18:5953850-5953872 AGTGAGAAGTGGGAAGAGGAAGG + Intergenic
1153815185 18:8784878-8784900 AGCGAGAAGGAGGAAGAGCAAGG - Intronic
1154021360 18:10666658-10666680 ACGGAGAAGCAGCCACAGGAAGG + Intronic
1154092174 18:11375666-11375688 AGTGAGTAGCAGCAAGTGACCGG + Intergenic
1154338667 18:13485518-13485540 AGCCACAAGCAGCATGAGGATGG - Intronic
1155567120 18:27147529-27147551 AGTGGGAAGGAGATAGAGGATGG - Intronic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155868327 18:30994242-30994264 AGTGAAAAGCAGGAAGAAGATGG - Exonic
1156060906 18:33075009-33075031 TGTGAGAAGGTGAAAGAGGATGG + Intronic
1156156029 18:34302657-34302679 AAGGAAAAGCAGCAAGAGAAAGG + Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156678852 18:39565416-39565438 AGTCAGCAGCAACAAGAGCATGG + Intergenic
1157175019 18:45443702-45443724 AATGAGAGGCAGAGAGAGGAGGG + Intronic
1157594244 18:48854228-48854250 AGTGAGAAGCAGGGAGGGCAGGG + Intronic
1157775159 18:50388772-50388794 CTTGAGCATCAGCAAGAGGAAGG - Intronic
1158156819 18:54435279-54435301 AGTGAGAAGCATAAAAATGAAGG - Intergenic
1158281944 18:55838124-55838146 AGGGGGAAGAAACAAGAGGAAGG + Intergenic
1158581569 18:58688852-58688874 ATTGAGAATCACCAAGAGGCCGG + Intronic
1158669935 18:59465327-59465349 AGAGAGAAGAAGAAAGAGAAAGG - Intronic
1159230616 18:65603905-65603927 AGGTAGAAGCAGTAATAGGAAGG - Intergenic
1159756059 18:72367594-72367616 AGAGAGAAGGAGAAAGTGGAAGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160553009 18:79707101-79707123 AGTGAGGAGGAGCATGTGGAAGG + Intronic
1160701824 19:511237-511259 AGGGAGGAGGAGGAAGAGGAAGG - Intronic
1160867591 19:1262620-1262642 AGTGAGAACCAGAAAGAGGGTGG - Intronic
1160925352 19:1542229-1542251 AGGGAGAAGAAGGAAGAAGAAGG - Intergenic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162087222 19:8256099-8256121 AGTGAGAAGCAGGAAAAAGCAGG + Intronic
1162393045 19:10401255-10401277 AGAAAGAAGCAGCAAGAGGTGGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163120439 19:15214057-15214079 AGTGAGAACCAGCAGGAGTGAGG + Intergenic
1163179319 19:15587831-15587853 AGTGAAAGGGAGCAAGAGGAAGG - Intergenic
1163429627 19:17259506-17259528 AGTCTGAAGCTGCAACAGGAGGG - Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1164234901 19:23323370-23323392 AGAGAGTAGGAGGAAGAGGAAGG - Intronic
1164732905 19:30519472-30519494 AGTCTGCAGCTGCAAGAGGAGGG + Intronic
1164742723 19:30588444-30588466 AATGGGGAGAAGCAAGAGGATGG + Intronic
1165345638 19:35247754-35247776 AGTGAGGAGGAGCCACAGGAGGG + Intergenic
1165644042 19:37418218-37418240 AATGAGAAGAACCAATAGGAAGG + Intronic
1165881437 19:39046784-39046806 AGTGAGATGCAGCCATGGGAGGG + Intergenic
1165956748 19:39505859-39505881 AGTGAGATGGAGCCACAGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166151907 19:40880982-40881004 AGAGAGATGGAGGAAGAGGATGG + Intronic
1166206948 19:41276298-41276320 GGTGAGTAGGAGCAAGAGAAGGG + Exonic
1167259703 19:48451386-48451408 ACTGAGGCTCAGCAAGAGGAAGG + Intronic
1167319214 19:48785560-48785582 AGGGAGAAAGAGCTAGAGGAGGG + Intergenic
1167350872 19:48973842-48973864 AATGTGAACCAACAAGAGGAAGG + Intronic
1168004989 19:53479441-53479463 AGTGAGAAGCTGAGAGAGAAAGG + Intronic
1168338342 19:55609633-55609655 ACTGAGGAGCAGCATGGGGAAGG - Intronic
1168572839 19:57484337-57484359 AGTGAGCTGCAGTAACAGGAAGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
926771054 2:16375553-16375575 AGTGAGAACGAGGAAAAGGATGG - Intergenic
926942292 2:18151373-18151395 TGTGAACAGCATCAAGAGGATGG + Intronic
927512864 2:23655228-23655250 TGGGAGACGCAGCAACAGGAAGG - Intronic
927703461 2:25282578-25282600 AGTGAGCCCCAGCCAGAGGAGGG - Exonic
929266883 2:39928430-39928452 GGTGAGAGGCTGGAAGAGGAGGG + Intergenic
929335986 2:40746290-40746312 ACTGCGAGGCAGCAAAAGGAGGG - Intergenic
929931348 2:46258509-46258531 AGAGAGAAGGAGGAAGAGGAGGG + Intergenic
930034600 2:47077680-47077702 AGTCAGTAGCGGGAAGAGGAGGG - Intronic
930055452 2:47248590-47248612 AGTGAGAAACAGGAAGACCATGG + Intergenic
930232484 2:48857349-48857371 GGTTAGAAAAAGCAAGAGGAAGG + Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932224899 2:70031801-70031823 TGTGAGATGGAGCAAGATGAAGG - Intergenic
932454732 2:71842110-71842132 AGAGAGAAACAGCAAGATCAAGG - Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933748619 2:85588769-85588791 AGTGAGGACCAGGCAGAGGATGG - Intronic
934616602 2:95775113-95775135 AGTGAGAAGAACCTAGAGGGAGG + Intergenic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
934837704 2:97605536-97605558 AGTGAGAAGGACCTAGAGGGAGG - Intergenic
935067007 2:99658115-99658137 AGTCAGAAGCAAGAAGAGAAAGG + Intronic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
936022371 2:109004599-109004621 AGTGAGAAGCGAGAAGAGGGTGG + Intergenic
936081327 2:109434562-109434584 ACTCAGAAGCAGGAAGAGGGTGG - Intronic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936538746 2:113333085-113333107 AGTGAGAAGCACCTACAGGTAGG + Intergenic
936548140 2:113410763-113410785 AGAGAGAGGAAGCAAGAAGATGG - Intergenic
937438558 2:121898340-121898362 AGTTAACAGCAGCAAGGGGATGG + Intergenic
937769011 2:125696685-125696707 AGTGACTAGAAGGAAGAGGAGGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
938061874 2:128261236-128261258 AGTGAGAAGGTGCAAGGGGTGGG + Intronic
938781529 2:134589109-134589131 AGTGAGAGGCAGCAGAAAGAAGG + Intronic
938940738 2:136167671-136167693 AGTCAGCAGCAGCGAGAGGCAGG - Intergenic
939108976 2:137983884-137983906 ATTAAGAAGCAGCAAATGGAAGG - Intronic
939847179 2:147261434-147261456 AGAGTGCAGGAGCAAGAGGAAGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940014208 2:149086501-149086523 AGTAAGACTCAGCAAAAGGAAGG - Intronic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
940900988 2:159126026-159126048 AGTGAGAAAAGGCAGGAGGAAGG - Intronic
941394955 2:164962888-164962910 AGTGAGAAGGAGCAAAAGAAAGG - Intergenic
941999711 2:171633784-171633806 AGAGAGAGGAAGGAAGAGGAGGG - Intergenic
942005414 2:171694795-171694817 AGTGAGCAAGAGCAAGAGGTGGG + Intronic
943196270 2:184754441-184754463 AGTGACAAGGAGCATGAGGTAGG - Intronic
943202843 2:184851370-184851392 ACTCAGAAGCAGAAAGAGAATGG - Intronic
943291314 2:186075562-186075584 AAGGAGAAGGAGGAAGAGGAGGG - Intergenic
943354811 2:186839878-186839900 AGGGGGAAGCAGCAAAGGGATGG - Intronic
944253332 2:197599499-197599521 TGTGAGAAGGAGAAAGAGGAAGG + Intronic
944346138 2:198668163-198668185 AGGGAGAAGAAGAAAGAGCAAGG - Intergenic
944465196 2:199993698-199993720 AGTCAGGAACAGCAAGAGAAGGG + Intronic
944589558 2:201204170-201204192 GGAGAGAAGAAGCAAGAGGAGGG + Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946538809 2:220661179-220661201 GTTGAGAAACAGCAAGAGAAAGG - Intergenic
946540410 2:220678100-220678122 AGAGAGAAGCTGCTAGATGATGG - Intergenic
946709718 2:222493318-222493340 AGAGAGAGGAAGCAAGAGCAGGG + Intronic
947361002 2:229345341-229345363 AGAGAGCAGAAGCAAGATGAAGG - Intergenic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947761084 2:232604444-232604466 AGTGGGAAGCTGGAAGAGAAGGG - Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
948247812 2:236501145-236501167 CGGGAGCAGGAGCAAGAGGAAGG + Intronic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948447136 2:238041418-238041440 ACTGAGAGGGAGCATGAGGACGG - Exonic
948554461 2:238797800-238797822 GGTGTGATGCAGGAAGAGGATGG + Intergenic
1169046820 20:2539864-2539886 AGTGAGAAGAAGAAAGAGGTTGG + Intronic
1169525989 20:6426259-6426281 AGAGAGAAGAAGAAAGAGAAGGG - Intergenic
1169825629 20:9765654-9765676 AGGGAGAAGCAGGGAGAGGGCGG - Intronic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170936122 20:20811250-20811272 ATGGAGAAGCAGCAAGAGTCTGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171045453 20:21806069-21806091 AGTGAGGAGGAGCTGGAGGAAGG - Intergenic
1172784793 20:37460694-37460716 AGTAAGAAGGAGGAAGAGGAAGG + Intergenic
1173410382 20:42804372-42804394 GGTGGACAGCAGCAAGAGGAAGG - Intronic
1173501094 20:43554113-43554135 AGTGAAAAGCACCTACAGGATGG + Intronic
1173817306 20:45997971-45997993 AGTGAGGAGAAGGAAGAGAATGG + Intergenic
1173878718 20:46394286-46394308 AGTAAGAACGAGCAACAGGAAGG - Intronic
1175651215 20:60725362-60725384 AGTGAGAATCAGCAACATGGAGG - Intergenic
1175849766 20:62083552-62083574 AGAGAGAAGGAGAAAGAGGAGGG - Intergenic
1176095022 20:63337149-63337171 GGAAAGAAACAGCAAGAGGAGGG + Intergenic
1176899521 21:14422139-14422161 AGCTAAAAGCAGCAAGAGAAAGG - Intergenic
1177606255 21:23381354-23381376 CACGAGAAGCAGCAAGAGGGAGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178606126 21:34037526-34037548 AGTGGGAGGCAGGAAAAGGATGG - Intergenic
1178775332 21:35544774-35544796 AGGGAGGATCAGCAAGAGGCAGG - Intronic
1179007313 21:37527224-37527246 GGTGAGAACCACCAAGAGGATGG + Intergenic
1179041072 21:37802571-37802593 AGTGAGAAGAGGCCAGAAGATGG + Intronic
1179837808 21:44049032-44049054 CCTGAGATGAAGCAAGAGGAGGG - Intronic
1180699003 22:17771720-17771742 AGAGAAAAGGAGGAAGAGGAAGG + Intronic
1181439163 22:22926989-22927011 AGGGAGGGGCAGCCAGAGGAAGG - Intergenic
1181849096 22:25737020-25737042 TGTCAGAAGAAGCAACAGGAAGG - Intergenic
1181901493 22:26159944-26159966 AGTGAGACAGAGAAAGAGGAAGG + Intergenic
1182051895 22:27318819-27318841 TCTGAGAAACAGCAAGAGGAAGG + Intergenic
1183328161 22:37205484-37205506 TGTGAGGAGAAGGAAGAGGAAGG - Exonic
1184259095 22:43304480-43304502 TGTGAGAAGCAGGAACAGGCAGG + Intronic
1184301602 22:43563995-43564017 AGTGATTTGCAGCTAGAGGATGG - Intronic
1185292290 22:50033107-50033129 AGTGAGAAGCAGCACGGGCAGGG - Intronic
1185393802 22:50576835-50576857 TGTGAGCAGCAGCCAGTGGAGGG - Exonic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
951053664 3:18122863-18122885 TGGGAGAGGAAGCAAGAGGAAGG - Intronic
952041692 3:29268790-29268812 AGAGGGAAGAAGCCAGAGGAAGG + Intergenic
952125630 3:30297278-30297300 AGTGAGAGGCAGTAGGAGGTAGG - Intergenic
952275926 3:31876612-31876634 AGTGAGAGGTAGCAAGAAGGTGG + Intronic
952685194 3:36139543-36139565 TATGAGATTCAGCAAGAGGAAGG + Intergenic
952749345 3:36812754-36812776 AGTAAGAAGCAGCTAGAGGCAGG + Intergenic
953158527 3:40396716-40396738 AGGGTGAAGCCTCAAGAGGAAGG - Intronic
953173567 3:40529266-40529288 AGTGAGAAGTAGAAGGAAGAAGG - Intronic
953290186 3:41652636-41652658 AGTGAAAAGCAGAAAGAGGTGGG + Intronic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954592695 3:51797181-51797203 AGTTAGAAGCTGCAAGATTATGG - Intergenic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955848165 3:63190678-63190700 AGAGAGAAGGAGAAAGAGGGAGG + Intergenic
956783803 3:72625500-72625522 AGTGACAAGGAGGAAAAGGAGGG + Intergenic
956928601 3:74017014-74017036 AGTGAGAAGATGCTGGAGGAAGG - Intergenic
957067470 3:75537526-75537548 AGTGACAGGGGGCAAGAGGACGG - Intergenic
957120340 3:76082428-76082450 AATGAGAAGCAGGAACAAGAGGG + Intronic
959511606 3:107219158-107219180 AGTGAGAAAGGGCAAGAGAAAGG + Intergenic
959971765 3:112417533-112417555 AGACATAAGCAGCAAGAGGAGGG + Intergenic
960024910 3:112998065-112998087 AGTGAGAAGCAGAAAGTGTGTGG - Intronic
960067362 3:113387883-113387905 AGTGAGAATCAGCAATAGCCAGG + Intronic
960270886 3:115673232-115673254 AGAGAGAAAGAGAAAGAGGAGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960547539 3:118933811-118933833 ATTGAGAAGCAGGAAGTAGAAGG - Intronic
961151076 3:124638474-124638496 AGTGAGAAGCAGTCAGAGAGGGG - Intronic
961239440 3:125397622-125397644 GGAGAGCAGCAGGAAGAGGAAGG + Intergenic
961285676 3:125800446-125800468 AGTGACAGGGGGCAAGAGGACGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
961953999 3:130781635-130781657 AGTAGGAAGGAGCTAGAGGATGG - Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963237788 3:142972569-142972591 AGAGAGAAACAGCAAGTGCAAGG - Intronic
963652943 3:148006989-148007011 AGAAAGAAGGAGGAAGAGGAAGG - Intergenic
963794031 3:149613406-149613428 AAAGACAAGCAGCAAGATGAAGG + Intronic
963846038 3:150159076-150159098 AGTGTGAAGCAGCAGAAGAATGG - Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964649732 3:158996963-158996985 ATAGAGAAGCAGCAAGATAAAGG - Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
965882414 3:173401486-173401508 AATAAGAAGAAGGAAGAGGAGGG + Intronic
966253189 3:177889666-177889688 AATGGGAAGCAGTCAGAGGAGGG + Intergenic
966306117 3:178536806-178536828 AGTGAGAAGCAGCAAGAGGAGGG + Intronic
966532095 3:180992605-180992627 AATGTGAAGGAGCAACAGGAAGG - Intergenic
966559188 3:181300075-181300097 AATGAGAAGGAGGAAGAGAAGGG + Intergenic
967071430 3:185965757-185965779 AGAGAGAGGAAGCAAGAGGGAGG + Intergenic
967207441 3:187137093-187137115 AGGCTGAGGCAGCAAGAGGATGG + Intronic
967851642 3:194087001-194087023 TGTGAAAAGCACCCAGAGGAAGG + Intergenic
967877278 3:194275890-194275912 AGTGGGGAGCGGAAAGAGGAGGG - Intergenic
967921733 3:194619130-194619152 CCTGAGCAGCAGCAAGAGCAAGG - Intronic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
969801408 4:9568510-9568532 AGTGACAGGGGGCAAGAGGACGG + Intergenic
970188736 4:13489763-13489785 AGCCAGGAGAAGCAAGAGGAGGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970839164 4:20446428-20446450 AGAGAGAAGCAGCAATAGTAGGG + Intronic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
971109645 4:23570783-23570805 AGTGAGAGGCAAAAAGAGAATGG - Intergenic
971139581 4:23909593-23909615 AGTGACAGGCAGAAGGAGGAGGG + Intergenic
971172799 4:24250608-24250630 AGAGAAAAGAAGGAAGAGGAAGG + Intergenic
971556302 4:28016396-28016418 AGTGAAAAGCAGCAGGTGAAAGG + Intergenic
971819282 4:31530623-31530645 AGTGAGAAGTAGCAGGGGCAGGG + Intergenic
971990805 4:33891090-33891112 AGAGTGAGGTAGCAAGAGGAGGG - Intergenic
972710742 4:41592062-41592084 AGGGAGAAGGGGCAGGAGGAGGG - Intronic
972757842 4:42068057-42068079 AGTGAGTATCAGCAATAGTAGGG - Intronic
973610936 4:52635514-52635536 AGTGAGAAGGGTCAAGGGGATGG - Intronic
973791749 4:54384617-54384639 AGTGAGGAGGGGCGAGAGGATGG + Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974694873 4:65353808-65353830 AGTGTGTAGCAGAGAGAGGAAGG - Intronic
975112312 4:70641828-70641850 AGAGAGAACCAGAAAGAGTATGG + Intronic
975631437 4:76407815-76407837 AGAGAAAAGAAGAAAGAGGAAGG + Intronic
975635889 4:76447710-76447732 AGTGTAAGGCAGCAGGAGGAAGG + Intronic
975888241 4:78991811-78991833 AGAGAGCAGCAGCAGGAGGCTGG + Intergenic
976444605 4:85116356-85116378 AGTGAGAAGAAGCAACCAGAAGG - Intergenic
976668484 4:87626040-87626062 ACTGAGAAGCAGTGAGAGGATGG - Intergenic
977686350 4:99851332-99851354 AATGAGAGACAGAAAGAGGAAGG + Intronic
978379093 4:108107785-108107807 AGTGAGAAGCAGCATGTTGGGGG - Intronic
979528345 4:121741128-121741150 AGAAAGCAGCAGCAAGTGGAGGG - Intergenic
979931388 4:126636026-126636048 CATGAGAAGCTGAAAGAGGAAGG - Intergenic
980082107 4:128355079-128355101 TGAGAGAGGCAGCAAGAGGAAGG - Intergenic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
981915246 4:150026132-150026154 AGAGAGAAGGAGCAAGAACAGGG - Intergenic
982134270 4:152258737-152258759 AGTGAAATGCAGGAACAGGAAGG - Intergenic
983869966 4:172813723-172813745 AGTGAGTAGCAGCCAAGGGAGGG + Exonic
984392593 4:179155905-179155927 TGTGTGCAGCAGCAAGAGGAGGG + Intergenic
984951644 4:185012267-185012289 AAAGAAAAGCAGCAAGTGGAGGG - Intergenic
985117364 4:186605302-186605324 AGTGAGAAGGGGGAGGAGGAGGG + Intronic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
986124095 5:4869397-4869419 AGAGAAAAGCAGGAAGAGCAAGG + Intergenic
986125630 5:4880472-4880494 AGTGAGAGACAGGAAGGGGAAGG + Intergenic
986266633 5:6196703-6196725 ATGTAGAGGCAGCAAGAGGATGG + Intergenic
987032852 5:13991503-13991525 AAGGAGAAGGAGGAAGAGGAGGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987315704 5:16721212-16721234 TTTGTGAATCAGCAAGAGGAGGG - Intronic
987807215 5:22784642-22784664 AGTAAGAAGAAGCAAGTAGAGGG - Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988095046 5:26596044-26596066 TGCCAGAAGAAGCAAGAGGAAGG - Intergenic
988985122 5:36610858-36610880 AGGCAGAAGCAGCAAGAAGAAGG + Intronic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
990568448 5:57053710-57053732 AGTGAAAACCTGCAAGAGGCTGG + Intergenic
991220702 5:64212257-64212279 AGTGAGGAGCAGTAAGAGGTTGG - Intronic
991433562 5:66573280-66573302 AGAGAGAAAGAGGAAGAGGACGG + Intergenic
991473408 5:66994119-66994141 AGTGAGGAGCACCAAGAGGAAGG + Intronic
992002046 5:72445303-72445325 ACTGAGGAGGAGCAACAGGAAGG + Intronic
992407470 5:76473444-76473466 AGAGAGAAGGAGAAAGAGGGAGG - Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994371749 5:98975631-98975653 ACTGACTAGCACCAAGAGGATGG + Intergenic
994691120 5:103020770-103020792 AATGAAAAGCAGCAACAGCAAGG + Intronic
995667477 5:114559386-114559408 AATGAGAAGGGGCATGAGGAGGG + Intergenic
996148120 5:120000005-120000027 AGGGAGAAGGAGATAGAGGAAGG + Intergenic
997506534 5:134421993-134422015 AAGGAGAAGGAGGAAGAGGAAGG - Intergenic
997559672 5:134835351-134835373 ATTGAAAAGCAGGAAGAGGCCGG + Intronic
997996402 5:138590243-138590265 AGTGAGAATCAGGAAGATGAAGG + Intergenic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
998185917 5:139980077-139980099 AGTGATAAGCAGAAATAGCATGG - Intronic
998392672 5:141797422-141797444 TGTGAGAAGAAGCAGGAGGGAGG - Intergenic
999125001 5:149240089-149240111 ACTGAGAAGCAGCAGGAAGGTGG + Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
999304811 5:150512571-150512593 AGAGGGAAGGAGCAAGAGAATGG - Intronic
999473251 5:151874916-151874938 AGTGATAGGGAGCATGAGGAGGG + Intronic
999795785 5:154988664-154988686 AGTGGGAAACAGAAAGAGGATGG - Intergenic
1001343045 5:170864612-170864634 ATTGAGAAGAAGTAAGAGGTAGG + Intronic
1001511093 5:172322455-172322477 AGAAAGAAGAAGGAAGAGGAGGG - Intergenic
1001543711 5:172557113-172557135 AGGGAGCAGAAGCAGGAGGAGGG - Intergenic
1002255198 5:177953350-177953372 GGAGAGAAGCAGGTAGAGGAGGG - Intergenic
1002276652 5:178108350-178108372 AGTCCGGAGCGGCAAGAGGATGG + Intergenic
1002398055 5:178973102-178973124 AGAGAGAGACAGCAAAAGGAAGG - Intergenic
1002473243 5:179450086-179450108 AGGCAGAAGGAGCAAGGGGAGGG + Intergenic
1002480978 5:179500567-179500589 AGGCAGAAGGAGCAAGGGGAGGG - Intergenic
1002482938 5:179515384-179515406 GGAGAGAAGCAGGTAGAGGAGGG + Intergenic
1002792784 6:447889-447911 AGGGAGAACGAGCCAGAGGAAGG + Intergenic
1002832640 6:836765-836787 AGTGCAAAGCACTAAGAGGAAGG + Intergenic
1002886083 6:1295509-1295531 AGTCAGGAGCAGGGAGAGGAAGG - Intergenic
1003464663 6:6367215-6367237 ACTGAGAAGCGGCAACAGCATGG + Intergenic
1003746051 6:9003955-9003977 AGGGAGAGGGAGGAAGAGGAGGG - Intergenic
1003824319 6:9935940-9935962 AGTGAGAAGCAGGAGGATGCTGG - Intronic
1004289487 6:14353046-14353068 ATTGAAAAGAAGCAAAAGGAAGG + Intergenic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1004866494 6:19858022-19858044 GGTGACAGGCAGCAACAGGAAGG - Intergenic
1004886390 6:20055049-20055071 AGAGAGAAGCAGCCACATGATGG + Intergenic
1006011391 6:31045603-31045625 GGTGAGAACCAGCAAGAGAGAGG + Intergenic
1006174997 6:32116346-32116368 GGTGAGAAGCAGCAGGAAGTAGG - Intronic
1007407971 6:41645620-41645642 AGTGAGACGCAGCAATAGCACGG - Intronic
1007452609 6:41951603-41951625 AGAGAGAAGCAGGAAGAAGAGGG + Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1008750964 6:54733431-54733453 CATGAGAAACAGCAAGAGGAAGG + Intergenic
1009038016 6:58141430-58141452 TGAGAGTAGCACCAAGAGGATGG + Intergenic
1009051891 6:58285443-58285465 AAAGAGAAGAAGCAAGAGGAAGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009213808 6:60895066-60895088 TGAGAGTAGCACCAAGAGGATGG + Intergenic
1009627189 6:66149450-66149472 AATGAGAAACATCAAAAGGAGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010285877 6:74077297-74077319 AGAGGGCAGCACCAAGAGGATGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010570136 6:77464989-77465011 ACTGAGCAGCTGGAAGAGGATGG - Intergenic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1011528016 6:88287668-88287690 ACTGAGAAGCTGGAAGAGGCTGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012891077 6:104898067-104898089 AGTGAGATGCACCAAGAGCAAGG + Intergenic
1013673652 6:112433248-112433270 AGAGAGAAGAAGCATGAGCAAGG + Intergenic
1013735432 6:113221894-113221916 AGTGAAGAGCAGGAAGAGGTGGG + Intergenic
1013867329 6:114714349-114714371 AGAGAAAAGAAGCAAGAGTAGGG + Intergenic
1014107510 6:117583358-117583380 AGTGAAAAGAAGCCACAGGATGG - Intronic
1014211689 6:118715191-118715213 AGAGAGAACTAGCAAGAGCAGGG + Intergenic
1014370129 6:120596081-120596103 AGTGAGAAACAGCAAGTAAAAGG - Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015517225 6:134095025-134095047 AATAAGAAGTAGGAAGAGGATGG + Intergenic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1017323561 6:153120488-153120510 ACTGAGAAACAGCAAAAGGCAGG - Intronic
1017440466 6:154460094-154460116 AGGGAGAAGCACCCAGAGCAGGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017698492 6:157043270-157043292 TTTGAAATGCAGCAAGAGGAAGG - Intronic
1018038080 6:159898665-159898687 AGGGAGGAGGAGGAAGAGGAAGG - Intergenic
1018052592 6:160024119-160024141 AGTGGGAGGCAGCAAGCTGATGG + Intronic
1018606819 6:165606397-165606419 AGTGAGAACAAGGTAGAGGAAGG - Intronic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1019638301 7:2088626-2088648 AGCGAGAGGCAGCAAGGGGACGG + Intronic
1019725684 7:2601239-2601261 AGTGAGAGGCAGAATTAGGATGG - Intronic
1020011383 7:4807632-4807654 AGAGAGAAGGAGCGGGAGGAGGG - Intronic
1020173951 7:5867584-5867606 AGAGAAAAGGAGAAAGAGGAGGG - Intergenic
1020288271 7:6703075-6703097 AGTGAGTGGCAGCATCAGGAAGG - Intronic
1021584554 7:22193831-22193853 AGTGAGATGGAGCAAGGGAAGGG + Intronic
1022052103 7:26686340-26686362 AGAGAGAAGGAGGAAGAGAAAGG + Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022517717 7:30986682-30986704 AGTGAGGAGCAGGATGAGAAGGG + Intronic
1022703009 7:32778868-32778890 AATGAGAGGCAGCAAGGGGCAGG - Intergenic
1023071740 7:36441573-36441595 ACTGAGGAGCAGCAAGAGGCAGG + Intronic
1023372400 7:39524794-39524816 AGAGAGTAGTAGCAAGAGCAGGG - Intergenic
1023485709 7:40684144-40684166 AGTGAGATGTAGTAAGAGAAGGG - Intronic
1024355920 7:48413225-48413247 AGACAGAAGCAGAAAGAGGAGGG - Intronic
1024435904 7:49354399-49354421 TGTGAGAGGTAGCAAGATGATGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026158963 7:67852272-67852294 AGTGAGGAGGAGCAGAAGGATGG + Intergenic
1026329351 7:69338259-69338281 AGTGATAAGTAGCAACGGGATGG + Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028030467 7:85905652-85905674 GGAGAGAAAGAGCAAGAGGAAGG - Intergenic
1028404124 7:90457659-90457681 AGTGAGAAGAAGGAAGGGCAAGG + Intronic
1028656999 7:93220033-93220055 TTTGAGAAACAGCAAGAGGCAGG + Intronic
1028831133 7:95327602-95327624 AATGAGAAGCCACAAGAGGGAGG - Intergenic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029956686 7:104647772-104647794 AGGAAGAAGGAGAAAGAGGAAGG + Intronic
1029966397 7:104745245-104745267 AGGAAGAAGGAGAAAGAGGAAGG - Intronic
1030195497 7:106849277-106849299 TGTGAAAGACAGCAAGAGGATGG - Intergenic
1031013705 7:116550089-116550111 ACTGGGAAGCAACAAGAGGGAGG + Intronic
1031051308 7:116949075-116949097 TGTGAGATGCAGCACCAGGAAGG - Intergenic
1031258281 7:119484008-119484030 AGTAAGAAGAAGGAACAGGATGG + Intergenic
1031374510 7:121007786-121007808 AAAGAGAAGCAGCAACAGGATGG - Intronic
1031375328 7:121017615-121017637 AGTCAGTAGCAGCAACAAGAAGG - Intronic
1031854629 7:126907299-126907321 AGGGAGGAGGAGGAAGAGGAAGG + Intronic
1032165639 7:129542665-129542687 AGAGAGATGCAGCTAGAGAAGGG - Intergenic
1032548997 7:132766886-132766908 GGTGAGCTGCAGCAGGAGGAGGG + Intergenic
1032738498 7:134714379-134714401 AGGGAGAACCTGCCAGAGGAAGG - Intergenic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1032848300 7:135770579-135770601 AGCTAGAAGCAGGCAGAGGAAGG + Intergenic
1032906193 7:136369970-136369992 AGTGAGAAGCAGTCACATGATGG + Intergenic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034574541 7:151985779-151985801 TGTAGGAGGCAGCAAGAGGAGGG - Intronic
1034726368 7:153339929-153339951 TGTGAGGAACAGCAAGAAGACGG - Intergenic
1035245903 7:157561817-157561839 AGGAAGATGCAGCAGGAGGATGG + Intronic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036192271 8:6680865-6680887 AGAGAGAAGGAGGGAGAGGAAGG - Intergenic
1036546238 8:9771963-9771985 AGTGAGAGGGAGAAAGAGGTGGG + Intronic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1037787279 8:21910591-21910613 GGTGAGAAGCAGCGAGGGGATGG - Intronic
1038336160 8:26647350-26647372 GGGGAGGAGCAGCAAGAGGTTGG - Intronic
1038425895 8:27463498-27463520 AGTGATGAGCAGCAGGAAGACGG + Exonic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1038898324 8:31812667-31812689 AGAGAGGAGCAGCGAGGGGAGGG - Intronic
1039021038 8:33206868-33206890 AGGGAGAGGGAGCAAGAGCAGGG + Intergenic
1039143059 8:34414965-34414987 AGTAAGAAAAAGCATGAGGATGG + Intergenic
1039152667 8:34524658-34524680 AGTGAGGAGTAGGAAGAGCAAGG - Intergenic
1039245964 8:35608554-35608576 AGTGGAAACCAGGAAGAGGAGGG - Intronic
1039330939 8:36535973-36535995 AGTGACAAGAAGTAAGAGGCTGG + Intergenic
1039390855 8:37179866-37179888 AGAGAGAAGAAGAAAGAAGAGGG - Intergenic
1040033924 8:42850627-42850649 AGTGAGAAGCAGACAGACAATGG + Intronic
1040682467 8:49829078-49829100 TGTGAGAAGCAGGCAGGGGATGG + Intergenic
1040741163 8:50578430-50578452 AGAGAGAGACAGCAAGAGCAAGG + Intronic
1041040704 8:53843333-53843355 ACTCCAAAGCAGCAAGAGGAGGG + Intronic
1041709005 8:60876176-60876198 GGTGAGTAGCAACAAGAGCATGG - Intergenic
1042207676 8:66345427-66345449 AGAGAGAGGCAACAAGAGGAAGG + Intergenic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043783809 8:84371090-84371112 CGTGAGGAGGAGCAAGAGGATGG - Intronic
1044464745 8:92489871-92489893 AATGAGAAGCATGAAAAGGAGGG - Intergenic
1044916035 8:97113305-97113327 AGAGAGCAGCAGCAGGAGAAGGG + Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045324348 8:101106602-101106624 AGAGTGAAGCAGCAGGATGAAGG + Intergenic
1045806215 8:106165480-106165502 AGAAAGAAACAGAAAGAGGAAGG + Intergenic
1046285894 8:112092485-112092507 AGTGAGGAGCAGCAGGGGCAGGG + Intergenic
1046547905 8:115674597-115674619 AGGGAGAAGGAGGGAGAGGAAGG - Intronic
1046776007 8:118164096-118164118 AGGGAGGAGTAGGAAGAGGAGGG + Intergenic
1047190063 8:122670387-122670409 AAGGAAAAGAAGCAAGAGGAAGG + Intergenic
1048288393 8:133160932-133160954 AGAGAGAAGCAGAAAGAGTGAGG + Intergenic
1048572484 8:135667295-135667317 ACTGAGCACCAGCAGGAGGAGGG - Intergenic
1048573154 8:135671465-135671487 AATGAGACGCAGGCAGAGGAAGG + Intergenic
1048977555 8:139681467-139681489 AGTGAGAAGCTGGGAGAGCAGGG + Intronic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049108690 8:140629535-140629557 AGTGAGAAGATGAAAAAGGAGGG + Intronic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1051190609 9:14507723-14507745 AGTGAGAAGAAGAAAGAGGTTGG + Intergenic
1051355422 9:16235689-16235711 AGCTAGAAACAGGAAGAGGAAGG - Intronic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1051583979 9:18707144-18707166 AATGATAAGCAGGAGGAGGAGGG + Intronic
1051657320 9:19395542-19395564 AATGAGGAACAGGAAGAGGATGG - Intergenic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1053416406 9:37949590-37949612 GGACAGAAGCAGCAAGGGGAAGG + Intronic
1053727419 9:41018025-41018047 AGAGAGAGGAAGCAAGAAGATGG + Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1056072759 9:83006233-83006255 AGAGAGATGCAGCAAAAGAAAGG - Intronic
1056761798 9:89420695-89420717 AGTGGGATGAAGCAAGAGCAAGG + Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057855290 9:98596640-98596662 AGTGAGAAATAGCAAGGGGCAGG - Intronic
1058540697 9:106009509-106009531 TGTGAGAAGCGCCAGGAGGAGGG - Intergenic
1058994952 9:110290629-110290651 AGTGAGAAGCAGACAGAAGTGGG - Intergenic
1059072427 9:111152831-111152853 AGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1059085683 9:111300171-111300193 AGAGAGAAGGAGGAAGAGAATGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1060439590 9:123626477-123626499 AGTGAGAAAAAGCAGGAGAAGGG - Intronic
1060589735 9:124809275-124809297 AGTGATAAGTATCAAGATGAAGG + Intronic
1060830896 9:126715574-126715596 AGAGAGAGGCAGAGAGAGGAAGG + Intergenic
1060917960 9:127402605-127402627 CATGAGAAGCAGCATGAGGGAGG - Exonic
1061433214 9:130544330-130544352 AGTGAGCAGATGCAAGAGGGAGG - Intergenic
1061926916 9:133810424-133810446 AGGAAGAAGAAGCCAGAGGATGG - Intronic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1185526701 X:785783-785805 AGTGATAAGCCGCAAGTGTATGG - Intergenic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186209815 X:7238428-7238450 AGTTAGCAGCAGCAACAGGATGG + Intronic
1186989793 X:15055212-15055234 AGAGAGAAGTACCAAGAGAAGGG - Intergenic
1187252949 X:17615546-17615568 AGCAAGAAACAGCAAGAGCATGG - Intronic
1187417873 X:19108752-19108774 AGTGAAAGGAGGCAAGAGGAGGG + Intronic
1187470530 X:19565540-19565562 AGTGAGAGCAAGCAAGAGTAAGG - Intronic
1187599297 X:20809032-20809054 GGTGAGAGGCAGGAAGAGAATGG - Intergenic
1187977197 X:24714899-24714921 AGTGAGTAGCAGGAAGATCATGG + Intronic
1188642252 X:32520924-32520946 AGAGAGCTGCAGAAAGAGGATGG - Intronic
1189169864 X:38898505-38898527 AGTCAAAGGCAGAAAGAGGAAGG + Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189211425 X:39287260-39287282 AGGGAGAGGCAGCACGAAGAAGG + Intergenic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1191785572 X:64914083-64914105 AGAGAGAAGAAGGAAGAGGAGGG - Intergenic
1191877271 X:65809583-65809605 AGTGAGAAGAAGCAGGATCAGGG - Intergenic
1192115055 X:68402153-68402175 AGTAAGAAGGAGCAAGAGAAAGG + Intronic
1192154339 X:68732687-68732709 AGAGAGAACGAGCAAGAGCAGGG + Intergenic
1192157398 X:68756880-68756902 AGAGAGAAGCAGCAGGGAGATGG + Intergenic
1192550719 X:72051573-72051595 AGGTAGGAGAAGCAAGAGGAAGG - Intergenic
1192966063 X:76178297-76178319 AGTGAGAAGCAGTAAGAAACAGG - Intergenic
1194306672 X:92257210-92257232 TGAGAGTAGCACCAAGAGGATGG + Intronic
1194366369 X:93018993-93019015 AGTGAGGAGCAGCAGAAGCAGGG - Intergenic
1194615391 X:96095098-96095120 TGTGAGAAGCAGGGAGAGGTAGG + Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195362900 X:104102250-104102272 AGTAAGGAGATGCAAGAGGAGGG + Exonic
1195635390 X:107108431-107108453 AGTGAATGGCAGCAGGAGGAAGG + Intronic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196064180 X:111444530-111444552 AGTGACAAGAAGCAAGACTAGGG + Intergenic
1196111660 X:111953100-111953122 ATTGAGCAGCAGCAAGAAGCAGG - Intronic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1197818740 X:130524729-130524751 AGAGAGAAAGAGGAAGAGGAGGG - Intergenic
1197859147 X:130950770-130950792 GGTGAGAAGCATGATGAGGAGGG + Intergenic
1198471417 X:136950458-136950480 AATGAGAAGCAGCGAAAGGGGGG - Intergenic
1198576357 X:138014053-138014075 GGTGGGAAGAAGAAAGAGGAAGG + Intergenic
1198708422 X:139475184-139475206 AATGAAAAGCAGCAAGCAGAAGG + Intergenic
1198708573 X:139476660-139476682 AGTGAAAAGCTGCAAGTAGAAGG + Intergenic
1198809176 X:140518147-140518169 AGTGAGATCCAGAGAGAGGAAGG - Intergenic
1199109926 X:143919733-143919755 AGAGAGAAGGAGGAAGAAGAAGG + Intergenic
1199162049 X:144624511-144624533 AGTGAGAGAGAACAAGAGGAAGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199681187 X:150225669-150225691 AGTGATTAGCTGCAAGAAGAGGG + Intergenic
1199867659 X:151867967-151867989 AGAGAGAAGGAGCAAGAGAGAGG - Intergenic
1200300349 X:154968272-154968294 GGTGAGAGAGAGCAAGAGGAGGG - Intronic
1200494971 Y:3871608-3871630 AGTGAGCAGAAGCAGGAAGATGG + Intergenic
1200674596 Y:6135255-6135277 AGTGAGGAGCAGCAGAAGCAGGG - Intergenic
1201146286 Y:11067095-11067117 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146388 Y:11067409-11067431 AGGGAGAAGAAGGGAGAGGAAGG + Intergenic
1201146592 Y:11068049-11068071 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201146606 Y:11068098-11068120 AGGGAGAAGAAGGAAGAGGGAGG + Intergenic
1201582161 Y:15521038-15521060 AGTTAGCAGCAGCACCAGGAAGG + Intergenic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic