ID: 966312906

View in Genome Browser
Species Human (GRCh38)
Location 3:178614843-178614865
Sequence GTGTCTGTGCATAAAGTGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966312906 Original CRISPR GTGTCTGTGCATAAAGTGTT AGG Intronic
902195282 1:14793595-14793617 GTGTCTGTGCCTAGAATGGTGGG + Intronic
903424406 1:23243112-23243134 GTGTATGTGTGTATAGTGTTAGG - Intergenic
904660122 1:32077760-32077782 GTGTCTATGCATGAAGCGTGTGG + Intronic
906726190 1:48046185-48046207 GTGTATGTGCATATAGGGTGTGG + Intergenic
907922494 1:58926722-58926744 GTGTTGGTGCATAAAGACTTGGG - Intergenic
908447490 1:64214339-64214361 GTGACTGTGCCTACAGTGATGGG + Intronic
909071171 1:70995231-70995253 GTGAATGTGCATAATGTGTTTGG + Intronic
912784163 1:112583538-112583560 GTGTATCTGCATATAGTGCTAGG - Intronic
918566258 1:185936928-185936950 GTGTCTTTTAACAAAGTGTTTGG - Intronic
922455164 1:225768465-225768487 GTGTTTGTGCATGAACTGTTGGG - Intergenic
922851687 1:228738221-228738243 GTATCTGTGCTTCAAGTGATGGG - Intronic
923038283 1:230300871-230300893 GAGTCTGTGAATAAAGCCTTGGG - Intergenic
1067927443 10:50524387-50524409 GTGATGGAGCATAAAGTGTTAGG - Intronic
1068163221 10:53294878-53294900 ATATATGTACATAAAGTGTTTGG - Intergenic
1073172998 10:101528468-101528490 GTTTCTGTGGATAAAGAGATAGG - Intronic
1075462550 10:122627331-122627353 GTGTGTGTGTATACAGTGTATGG - Intronic
1076440503 10:130478128-130478150 GTGTTTGTGAATAAAATTTTAGG - Intergenic
1077584963 11:3444137-3444159 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1082211149 11:49503301-49503323 GTGTCTGTGAAGAATGTCTTGGG - Intergenic
1083190860 11:61051375-61051397 GTGTCTGTGCAGAAGGGGGTGGG - Intergenic
1084725187 11:70937203-70937225 GCATCTGTGCATCTAGTGTTTGG - Intronic
1084830476 11:71765148-71765170 GTGTTTGTGCAAAAAGAGGTTGG + Intergenic
1086638497 11:89121758-89121780 GTGTCTGTGAAGAATGTCTTGGG + Intergenic
1087217275 11:95507553-95507575 GTTTCTGTGCATCAGGAGTTTGG + Intergenic
1089427406 11:118390708-118390730 CTGTCTGTGCAAAGAGAGTTGGG - Exonic
1091033362 11:132211465-132211487 CTGTCTGGGCATAAAGTATTTGG - Intronic
1091534556 12:1393638-1393660 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1091828818 12:3534976-3534998 GTGTCTATCTATAAAGTGCTTGG + Intronic
1092412108 12:8261399-8261421 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1093298578 12:17423733-17423755 GTGTATTTGCATATATTGTTGGG + Intergenic
1093564269 12:20583312-20583334 GTTTCAGTGAATAAAGAGTTTGG + Intronic
1093822521 12:23638729-23638751 GGGTCTGTGAATATTGTGTTAGG + Intronic
1094297912 12:28928532-28928554 GTGTCTGTGGATACAGTGAAGGG + Intergenic
1097782083 12:63719373-63719395 GTTTCTGTACATACAATGTTTGG - Intergenic
1101484031 12:105132820-105132842 GTGTGTGTGTGTAAAGTGCTTGG + Intronic
1103165806 12:118769478-118769500 GTGTGTGTGCATATATTGGTTGG + Intergenic
1106220069 13:27739274-27739296 GTTTCTGTGCATATAATGTGTGG - Intergenic
1106595520 13:31132163-31132185 GTGTCTGTGCAGAGGATGTTGGG + Intergenic
1109531938 13:63661294-63661316 GTGTCTTGGCATAAATTTTTTGG + Intergenic
1110406346 13:75154554-75154576 GAGTCTGTTCATACAGTGTCTGG + Intergenic
1112144484 13:96682257-96682279 GTGTTTGTGCATAAATATTTAGG + Intronic
1112524021 13:100126363-100126385 TTTTCTATGCATAAAGGGTTTGG + Intronic
1114405243 14:22450305-22450327 GTGTCTGTAAAAAAAGAGTTTGG + Intergenic
1114625647 14:24128056-24128078 CTGTCTTTGCCTAAAGTGCTGGG - Intronic
1115861413 14:37690123-37690145 GTGTTTATGCAAACAGTGTTAGG + Intronic
1116803903 14:49472653-49472675 GTGTCTGTTGATAAACTTTTGGG - Intergenic
1118086965 14:62428882-62428904 GTGTCTGAGAATACACTGTTGGG - Intergenic
1120281743 14:82447401-82447423 TTGTCTATGCCTAAAATGTTGGG - Intergenic
1120633978 14:86928492-86928514 GTTTCTGTGTCTAAAGTGCTTGG + Intergenic
1120673788 14:87394913-87394935 GTTGCTGTTTATAAAGTGTTTGG + Intergenic
1121684166 14:95819985-95820007 GTTTTTGTGTGTAAAGTGTTTGG - Intergenic
1122000571 14:98648240-98648262 CTGTGTGTTCATAAAGTGCTTGG + Intergenic
1124121558 15:26893185-26893207 GTGTGTGTGTATAGTGTGTTGGG + Intronic
1125112833 15:36053444-36053466 CTGTGTGTGGATAAATTGTTTGG + Intergenic
1126777018 15:52109123-52109145 GAGCTTGTGCATTAAGTGTTGGG + Intergenic
1128731576 15:70025041-70025063 GAGTCTTTGCACAAACTGTTGGG + Intergenic
1130865369 15:87929287-87929309 GTCTCGGTGCACAAAGTGCTGGG + Exonic
1137832876 16:51560939-51560961 GTGTGTGTGTATATAATGTTTGG - Intergenic
1138576806 16:57912735-57912757 GTGTGTGTGCATTGTGTGTTGGG + Intronic
1140290429 16:73649451-73649473 GTGTATATGCATAAAGAGTTTGG + Intergenic
1141632224 16:85294339-85294361 GAGTCTGCGCTTAAAGTGTGAGG + Intergenic
1142529662 17:571335-571357 GTGTCTGTGCATTACGTGTGTGG + Intronic
1143578286 17:7807980-7808002 GTGTCTGTGCATATGTTGTGTGG + Intronic
1143755255 17:9062308-9062330 GTTTCTGTACCTAAAGTGTTGGG + Intronic
1149488742 17:57066327-57066349 GTGTGTGTGTATAAAATCTTTGG - Intergenic
1153555483 18:6308717-6308739 GTATATGTGCATAAAAGGTTTGG + Intronic
1153910722 18:9704592-9704614 CTGGCTGAGCTTAAAGTGTTGGG - Intergenic
1155606525 18:27612604-27612626 GTGTCTGTTCATATGGTGATAGG - Intergenic
1156311752 18:35929296-35929318 GAGTTTGTGTATAAAGTGTGAGG - Intergenic
1156677775 18:39551517-39551539 GTATGTGTGCATAAAGTCATGGG - Intergenic
1159250142 18:65865324-65865346 GTGTCTGTGCATAAAAGTTTGGG + Intronic
1159304026 18:66616337-66616359 ATCTCTGTGCAGTAAGTGTTGGG - Intergenic
1159748341 18:72268480-72268502 GTATCTGTGCAGAAGGTGTTTGG - Intergenic
1160342239 18:78099583-78099605 ATGTCTGTACATAGAGTATTTGG + Intergenic
1160430653 18:78810266-78810288 GTGTGTGTGCATGTAGTGTCTGG - Intergenic
1164544131 19:29145044-29145066 GTGTCTGTGAAAGAAGTATTGGG - Intergenic
1164621098 19:29696553-29696575 GTGTCTGGGTATCTAGTGTTTGG - Intergenic
1166273341 19:41732735-41732757 CTGTCTGTGCACAAAGTTTAAGG + Intronic
1168151288 19:54450161-54450183 GTGTCTGGACATAAAGCTTTGGG - Intronic
925577493 2:5375486-5375508 GTGTGTGTGTATAAAATGTATGG + Intergenic
927490975 2:23520670-23520692 GTTTCTTTCCTTAAAGTGTTGGG - Intronic
930084138 2:47480696-47480718 GTGTCTGTGATCAAAGTTTTGGG + Exonic
932163902 2:69488566-69488588 GTGTGTATAAATAAAGTGTTTGG + Intronic
932843659 2:75111819-75111841 GTGGTTGTCCATAAAGTGGTAGG + Intronic
933283065 2:80354183-80354205 GTTTCTTTCAATAAAGTGTTTGG - Intronic
933753576 2:85619331-85619353 GAATCTGTGCAGAAAGTTTTTGG + Intronic
937821772 2:126318505-126318527 GTGGTTATGCATAAAGTTTTGGG - Intergenic
938416416 2:131106500-131106522 GTGTCTGTGCATACATGTTTTGG - Intronic
939701992 2:145403478-145403500 CTGACTGTGTATAAAGTATTAGG - Intergenic
940141113 2:150491479-150491501 GTGACTGTGAATAAACTATTGGG - Intronic
940366842 2:152857828-152857850 GTGTGTGTGTATACAGTATTGGG - Intergenic
940366991 2:152859245-152859267 GTGTGTGTGTATACAGTATTGGG - Intergenic
940813016 2:158266703-158266725 GTGTGAGAACATAAAGTGTTTGG + Intronic
941713775 2:168742806-168742828 GGGTCTTTGTATAAGGTGTTTGG + Intronic
942977698 2:182038712-182038734 CTGTGTGTGCCTAATGTGTTTGG + Intronic
946343771 2:219091130-219091152 GTATCTGTGGAAAAAGTTTTGGG + Intronic
946954879 2:224918369-224918391 GTGTCTGTGCAATGAGTGTGTGG + Intronic
947755940 2:232565254-232565276 ATGTCTGTGCATAAACTGACAGG - Intronic
1172133766 20:32673593-32673615 CTGTCTGTGCTGAAAGTGTGGGG - Intergenic
1172880803 20:38198831-38198853 GTCTCTCTGCATAGACTGTTTGG + Intergenic
1174797030 20:53530847-53530869 GTGTGTGTGCATACAGAATTGGG - Intergenic
1175928764 20:62483736-62483758 ATGTATGTGCATTAAGTGTGGGG - Intergenic
1176920804 21:14685063-14685085 ATGGCTGGGCATTAAGTGTTTGG - Intergenic
1178550549 21:33534644-33534666 ATGTCTGTCCATAAACTCTTTGG + Exonic
1179918239 21:44492017-44492039 CTATCTGTGCATAATGTGTGTGG + Intergenic
1182879770 22:33723515-33723537 GTGTCTGTGTGTAAGGTTTTTGG - Intronic
950243462 3:11393118-11393140 GTGCCACTGCAGAAAGTGTTAGG + Intronic
955217722 3:56998222-56998244 GTGTGTGTGCAGAGAGAGTTTGG - Intronic
955791109 3:62589654-62589676 GGGGCTGTGCACAAAGTCTTTGG + Intronic
956020737 3:64930780-64930802 GTGACTGTGCTTTAAGTTTTAGG - Intergenic
956029460 3:65021757-65021779 TTGTGTGTGCCTACAGTGTTAGG - Intergenic
959317270 3:104823511-104823533 GGGGGTTTGCATAAAGTGTTTGG + Intergenic
960171738 3:114470132-114470154 GTATCTCTCCATAAAATGTTAGG + Intronic
960476749 3:118139791-118139813 TTATCTGTTCATAAAGTTTTTGG + Intergenic
961360181 3:126362185-126362207 GTGTCTGTACAACAAGTGTATGG + Intergenic
962483479 3:135817535-135817557 GTGTCTGGGCTTGAAGAGTTAGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966175208 3:177131227-177131249 GTGTCTTTGAATGAAGAGTTAGG - Intronic
966312906 3:178614843-178614865 GTGTCTGTGCATAAAGTGTTAGG + Intronic
966961130 3:184940094-184940116 ATATCTGTGCATAAAGGGATAGG + Intronic
967912254 3:194552129-194552151 GTGTGTGTGCGTAAAGTATGAGG - Intergenic
969000157 4:3973980-3974002 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
969813753 4:9670823-9670845 GTGTTTGTGCAAAAAGAGGTTGG + Intergenic
970530935 4:16982719-16982741 GTTTCTGTGCATCAGGAGTTTGG - Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971080399 4:23203521-23203543 GTTTATGTGCTTAAAGTATTTGG - Intergenic
971596590 4:28537102-28537124 GTGTCTATAAATAAAGTGTGAGG + Intergenic
972359151 4:38311395-38311417 GTCACTGTGCATAAAGTATTTGG + Intergenic
973220594 4:47721979-47722001 GGGTCTGTGGAAATAGTGTTTGG - Intronic
974987248 4:69043164-69043186 GTGTGTATGGAAAAAGTGTTAGG + Intronic
977624633 4:99176810-99176832 GTGTTGGTGCATACAGAGTTAGG + Intergenic
977705342 4:100064488-100064510 GAGTGAGTGAATAAAGTGTTAGG + Intergenic
977984335 4:103364003-103364025 GTGTGTGTGTATAAAGACTTAGG + Intergenic
979322251 4:119337937-119337959 GAGTCTGTGCAGAAAAGGTTAGG + Intergenic
980342700 4:131570555-131570577 GTGTCTGTGCATATGATGTATGG - Intergenic
980457901 4:133069293-133069315 GTGCCTGAGCATGAAGTTTTGGG - Intergenic
983122313 4:163901846-163901868 GTGGCTCTGCCTCAAGTGTTTGG + Intronic
983158135 4:164377578-164377600 GTGTGTGTGCATAAAAAGTAAGG - Intronic
983240232 4:165223549-165223571 GAGTCTGTGCAGAAAAGGTTAGG + Intronic
986564122 5:9093838-9093860 GTGACTGTGCTTCCAGTGTTAGG + Intronic
987481176 5:18459725-18459747 GTATCTCTGCATGAAGTGATTGG - Intergenic
989619645 5:43371718-43371740 GTGTCTGTGGATAAGGAATTTGG - Intergenic
991654442 5:68889618-68889640 ATGATTGGGCATAAAGTGTTTGG - Intergenic
991730821 5:69586232-69586254 GTCTCTCTGCTTAATGTGTTAGG + Exonic
991807257 5:70441394-70441416 GTCTCTCTGCTTAATGTGTTAGG + Intergenic
991864129 5:71041624-71041646 GTCTCTCTGCTTAATGTGTTAGG - Exonic
992025805 5:72667725-72667747 GTGTGTGTGTGTATAGTGTTTGG + Intergenic
998297197 5:140982801-140982823 GTGTGTGTGTATGAAGTTTTTGG + Intronic
999702245 5:154238870-154238892 GTTACTGTGCACCAAGTGTTCGG + Intronic
1001852902 5:174984979-174985001 GTGTCTGTGGCAAAAGTGTTGGG + Intergenic
1003725869 6:8763020-8763042 GTGTGTGTGTATAAAATGTCAGG + Intergenic
1003848506 6:10198328-10198350 GTGTCAGTGGGTATAGTGTTTGG - Intronic
1004084288 6:12429453-12429475 GTGTGTGTGCATAAAGTGTGTGG + Intergenic
1006925866 6:37654844-37654866 GTGTCTGTGCGTAACGTGTGCGG - Exonic
1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG + Intronic
1008058710 6:46974098-46974120 GTGTGTGTGCATGAAGTGTGAGG - Intergenic
1009733422 6:67640704-67640726 GTGTATGTGCATAAATTGTCTGG - Intergenic
1009753965 6:67910775-67910797 GTGTCTGTAGATAAATTATTTGG + Intergenic
1010087969 6:71943390-71943412 GTCTTTGGGCAAAAAGTGTTTGG - Intronic
1011617514 6:89210723-89210745 GTGAATGTTCATGAAGTGTTGGG - Intronic
1013071422 6:106732670-106732692 GTGTGTGTGTATGATGTGTTGGG - Intergenic
1015229644 6:130899647-130899669 GTGTCTGTGCTCAGAGGGTTTGG + Intronic
1016127762 6:140427421-140427443 GTATCTGGGCATTAAGAGTTAGG + Intergenic
1016837172 6:148489876-148489898 GTGTGTGTGTGTATAGTGTTAGG + Intronic
1020515142 7:9107927-9107949 GTGTCTGGGCATTAAATATTAGG - Intergenic
1020912930 7:14155879-14155901 GGGTCTGTGCATGTGGTGTTCGG + Intronic
1021055979 7:16046828-16046850 GTTTCTGTCCAAAAAGGGTTGGG + Intergenic
1022048175 7:26639743-26639765 GTGTCTGTGTATGACGTGTGTGG - Intronic
1022940686 7:35235473-35235495 GTTTCTGTACATACAATGTTTGG - Intronic
1022974039 7:35540891-35540913 GAGTTTGTGAATAAATTGTTTGG + Intergenic
1023366585 7:39470572-39470594 GTGTGTGTGTATAAAGGGGTTGG - Intronic
1023586680 7:41738194-41738216 GTGTCTGAGTATAAAGTGATAGG + Intergenic
1024813289 7:53238227-53238249 GTCTCTGTGCTTAAAAAGTTAGG + Intergenic
1026176865 7:68005754-68005776 GTGTCTGTCCATGAAGTGCAGGG + Intergenic
1029885732 7:103869083-103869105 CCCTCTGTGCATAAAGGGTTGGG + Intronic
1031829775 7:126612591-126612613 GTATCTGTGCAATAAATGTTTGG - Intronic
1031930899 7:127684827-127684849 GTCTGTGTGCTTAAGGTGTTGGG + Intronic
1033601348 7:142891215-142891237 GTGTGTGTGCATGATGTGTGTGG - Intergenic
1033880978 7:145883507-145883529 GTGCCTGTACATAAAGTCTGAGG + Intergenic
1034889069 7:154823520-154823542 GTGCCTGCGGATAAAGTTTTAGG + Intronic
1035214629 7:157355983-157356005 GTGTTTGTGCATATGGTGGTGGG - Intronic
1036377075 8:8209976-8209998 GTGTTTGTGCAAAAAGAGGTTGG + Intergenic
1036852471 8:12213173-12213195 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1036873839 8:12455696-12455718 GTGTTTGTGCAAAAAGAGGTTGG - Intergenic
1038973191 8:32660775-32660797 GTTGGTGTTCATAAAGTGTTTGG + Intronic
1044155545 8:88841454-88841476 TTGTCTTATCATAAAGTGTTGGG + Intergenic
1045132384 8:99168374-99168396 GTGTCTGTGATTATACTGTTGGG + Intronic
1047001470 8:120577470-120577492 GTCTCAAGGCATAAAGTGTTTGG + Intronic
1047696000 8:127404387-127404409 GTGTCTGTGCACAAAGTTGGAGG + Intergenic
1052497620 9:29247330-29247352 TTGTCTGTGCATAGGGTGATGGG - Intergenic
1054682728 9:68237245-68237267 ATGTCAGTGCCTAAAGTTTTGGG - Intronic
1056705421 9:88948611-88948633 GTGTCTGTGCGCACAGTGTGGGG + Intergenic
1202781747 9_KI270718v1_random:4807-4829 ATGTCAGTGCCTAAAGTTTTGGG + Intergenic
1188000529 X:24976342-24976364 GTGGCTGTGCATACAGAGGTGGG - Intronic
1194783709 X:98057003-98057025 GTGTCTGGGCTTGAAGAGTTAGG + Intergenic
1196288184 X:113907003-113907025 GTGGCTTTGCATATAGAGTTAGG + Intergenic
1199627697 X:149756293-149756315 GAGTATCTGCATAAATTGTTTGG - Intergenic
1200001327 X:153062151-153062173 GTGTCTGTTCATAAGCTGATGGG + Intergenic
1200949353 Y:8879001-8879023 GTGTCTGTACATCAATTCTTGGG - Intergenic