ID: 966316606

View in Genome Browser
Species Human (GRCh38)
Location 3:178654022-178654044
Sequence ATCTATAACCTAAAGCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966316606 Original CRISPR ATCTATAACCTAAAGCTTCT AGG (reversed) Intronic
900433548 1:2614757-2614779 ATCAAAAACCAACAGCTTCTAGG - Intronic
901295366 1:8157036-8157058 ATAAAAATCCTAAAGCTTCTGGG + Intergenic
903209497 1:21809019-21809041 CACTGTAACCTCAAGCTTCTGGG + Intergenic
904729066 1:32574519-32574541 CACTATAACCTCAAACTTCTGGG - Intronic
907077340 1:51590823-51590845 CACTATAACCTCAAACTTCTGGG + Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
911211152 1:95139097-95139119 CACTATAACCTCAAACTTCTAGG - Intronic
911517646 1:98886963-98886985 ATATATAACCTATTGCTCCTAGG - Intergenic
916041621 1:160966284-160966306 CACTGTAACCTAAAGCTCCTGGG - Intergenic
918366212 1:183810580-183810602 TTCTATGACCTAATGTTTCTAGG - Intronic
919150060 1:193685090-193685112 TTCTATGACCTAAATCTTCTAGG + Intergenic
919613767 1:199779321-199779343 ATGTATAACCACTAGCTTCTGGG + Intergenic
924612538 1:245586070-245586092 CACTATAACCTCAAACTTCTAGG + Intronic
1062760703 10:15315-15337 CACTATAACCTCAAGCTCCTGGG + Intergenic
1063272404 10:4525321-4525343 CTCTATTAGCTCAAGCTTCTGGG - Intergenic
1067141648 10:43662886-43662908 TACTATAACCTCAAACTTCTGGG + Intergenic
1068881445 10:62053612-62053634 ATCTATAACAGAAATCTTCATGG + Intronic
1073945764 10:108748035-108748057 CTTAAGAACCTAAAGCTTCTAGG - Intergenic
1075213233 10:120509553-120509575 ATCTGTAAACTAAAGCTTTTGGG + Intronic
1075617138 10:123898560-123898582 CACTATAACCTCAAGCTCCTGGG - Intronic
1080505257 11:32906472-32906494 CTCTGTAACCTGAAGCTTCTGGG + Intronic
1081018872 11:37917692-37917714 ATCTATAACCAAATTCTTGTTGG + Intergenic
1081411518 11:42764134-42764156 CACTATAACCTCAAACTTCTGGG + Intergenic
1082908942 11:58347878-58347900 ATAAATAACCTCAAGCTTCTTGG + Intergenic
1085138228 11:74114110-74114132 ATCTATAACATAAAGCTTTAGGG - Intronic
1085665833 11:78415497-78415519 ATGTGTAACCTTAAGCCTCTGGG - Intronic
1088189776 11:107215638-107215660 AACTAGAGCCTAAATCTTCTGGG + Intergenic
1089690515 11:120184176-120184198 ATTTCTAACCTAAATCTTTTCGG - Intronic
1091514048 12:1160249-1160271 ATGTATCACCTAAATCTTTTGGG - Intronic
1091678671 12:2510530-2510552 ATCTATACCCCAAGGCCTCTGGG - Intronic
1093633002 12:21432179-21432201 ATCTCTCACCTACAGGTTCTGGG - Intergenic
1093964326 12:25309338-25309360 TTGTATAAGCAAAAGCTTCTAGG + Intergenic
1095598940 12:43992884-43992906 GTCTTTAACCTCAAGCCTCTTGG - Intronic
1097549247 12:61046456-61046478 CACTATAACCTCAAGCTCCTAGG - Intergenic
1099132422 12:78851874-78851896 ATCAATTACCCAAAGATTCTCGG + Intergenic
1101901589 12:108794788-108794810 ATCTTTACCCTAAAGCTTTTCGG + Intronic
1102252857 12:111399213-111399235 ATCTATAGCCTTGAACTTCTAGG - Intergenic
1102712559 12:114940849-114940871 ATGTATAAGCTAGAGTTTCTTGG - Intergenic
1103298543 12:119908977-119908999 AACTGTAACCTCGAGCTTCTAGG + Intergenic
1104679790 12:130741619-130741641 ATTAAGACCCTAAAGCTTCTAGG + Intergenic
1105516208 13:21093091-21093113 ATCTAGATCCTAGAGCTCCTAGG + Intergenic
1106270320 13:28146585-28146607 GTCTATAACCTGTTGCTTCTAGG + Intronic
1106879554 13:34114461-34114483 ATATTGAACCTAAATCTTCTTGG - Intergenic
1109437651 13:62327271-62327293 ATCTAAAATCTAAAAATTCTTGG - Intergenic
1109953869 13:69539820-69539842 ATCTCTAACCTAAATATACTTGG + Intergenic
1113258564 13:108534322-108534344 TTCACTATCCTAAAGCTTCTAGG + Intergenic
1114030897 14:18580003-18580025 AACTATAACCTCAAACTCCTGGG - Intergenic
1115280920 14:31662426-31662448 ATAGATAACCTAAAGCATGTGGG - Intronic
1115953280 14:38745983-38746005 ATTTATAATCCAAAGCCTCTGGG + Intergenic
1116081666 14:40181646-40181668 CTCTGTAACCTCAAACTTCTGGG + Intergenic
1116529997 14:45958664-45958686 ATCTAAAACCAAAAGTTTCTAGG - Intergenic
1117687481 14:58269377-58269399 CTCTTCAACCTATAGCTTCTTGG - Intronic
1120212523 14:81647646-81647668 ATCTACAACAAAAAGCTGCTTGG - Intergenic
1126013218 15:44323417-44323439 ATCTAAAACCTTAAGCTTGGAGG - Intronic
1134798190 16:17060671-17060693 ATCTCTATCCTACAGCTTGTAGG + Intergenic
1136562316 16:31047274-31047296 CTCTATAACCTCGAACTTCTGGG + Intergenic
1137858732 16:51823586-51823608 ATGTAAAACCTCAAGTTTCTAGG - Intergenic
1139716087 16:68814245-68814267 ATCAAGAAGCTAAGGCTTCTTGG + Intronic
1139945321 16:70637303-70637325 TTGTAAAACCTAAAACTTCTAGG - Intronic
1140782693 16:78311065-78311087 ATCTGTACCCCATAGCTTCTGGG - Intronic
1144133801 17:12273368-12273390 AGTTTTAACCTAATGCTTCTAGG - Intergenic
1144224686 17:13133464-13133486 TTCTACAACCTAAATCTTGTAGG + Intergenic
1149633371 17:58144614-58144636 ACCTATAACCTCAAACTCCTGGG - Intergenic
1150172420 17:63012725-63012747 CACTATAACCTCAAACTTCTAGG + Intronic
1151152871 17:72103148-72103170 TTCTAAACCCTAAAGATTCTGGG + Intergenic
1152953610 18:15669-15691 CACTATAACCTCAAGCTCCTGGG + Intergenic
1153869231 18:9301657-9301679 CACTATAACCTCAAACTTCTGGG + Intergenic
1155401317 18:25442438-25442460 CTCTGTAACCTCAAACTTCTGGG + Intergenic
1157849643 18:51036050-51036072 CTCTATAACCTTCAACTTCTGGG + Intronic
1158149706 18:54354519-54354541 GATTATAACCTAAAACTTCTTGG + Exonic
1159388867 18:67761970-67761992 CTCTATAACATAAAGGTTCAAGG + Intergenic
1159584048 18:70266041-70266063 TTCTAGAACTTAATGCTTCTTGG - Intergenic
1159676980 18:71296846-71296868 AAATATAACCTCAAGTTTCTTGG - Intergenic
925096960 2:1213061-1213083 ATCTATAACCACTACCTTCTGGG + Intronic
928208680 2:29306787-29306809 ATTTATAACCTATATCTACTAGG - Intronic
929275126 2:40016915-40016937 ATCTATAACCAAGAGGCTCTTGG + Intergenic
929658458 2:43757739-43757761 ATATAGATTCTAAAGCTTCTGGG - Intronic
930564710 2:53004810-53004832 AACTAAAACCAAAAGCTTCAGGG + Intergenic
933326827 2:80848522-80848544 ATGTATAACCTAAGACTTTTGGG - Intergenic
942465181 2:176200415-176200437 AACTATAGCCTCTAGCTTCTGGG + Intergenic
943333155 2:186584835-186584857 CACTGTAACCTCAAGCTTCTGGG + Intergenic
945327537 2:208499963-208499985 ATTTATAAACTAAAGAATCTTGG - Intronic
1168792349 20:587416-587438 TTCTATAACCTATTTCTTCTAGG + Intergenic
1169549720 20:6689857-6689879 ATCAAAAACATAATGCTTCTGGG - Intergenic
1170929415 20:20755309-20755331 ACTTATAACCTATGGCTTCTGGG + Intergenic
1173442312 20:43088874-43088896 ATCTAGAACCTCTAGATTCTAGG - Intronic
1177497635 21:21910293-21910315 CACTATAACCTCAAACTTCTGGG - Intergenic
1177773012 21:25538220-25538242 GTCTATAACCCAAATCATCTGGG + Intergenic
1178758729 21:35379601-35379623 CACTATAACCTCAAACTTCTGGG + Intronic
1180455010 22:15507061-15507083 AACTATAACCTCAAACTCCTGGG - Intergenic
1183346320 22:37310250-37310272 ATTTATGACATAGAGCTTCTCGG - Intronic
1183413689 22:37670824-37670846 CACTATAACCTCAAACTTCTGGG - Intergenic
1183805387 22:40205514-40205536 ACCTAGATCCCAAAGCTTCTAGG - Intronic
1185389719 22:50552580-50552602 ATATATAACCTCCACCTTCTGGG - Intronic
953772705 3:45791243-45791265 ATATATAATATAAACCTTCTAGG - Intronic
955557396 3:60152714-60152736 CTCTATAACCTATACCATCTGGG + Intronic
956285062 3:67599568-67599590 ATCTAGCACCTGAAGATTCTGGG + Intronic
956771715 3:72532317-72532339 ACCTAGAAGCTAAAGCCTCTGGG + Intergenic
957165834 3:76672620-76672642 ACCTCTAACCTAGAGCATCTAGG - Intronic
957206851 3:77210014-77210036 ATTTATAATGTAAAGATTCTTGG - Intronic
959239988 3:103778593-103778615 ACTTATAGCCTAAAGCTTTTTGG + Intergenic
959402870 3:105923846-105923868 TACTACAACCTCAAGCTTCTGGG - Intergenic
959444659 3:106424077-106424099 TGCTATATCCTAAAGCTTTTTGG + Intergenic
960433305 3:117596075-117596097 ATCTATAACCTAAAGCAGCCAGG + Intergenic
961959561 3:130840445-130840467 AACTATAAACAAAGGCTTCTGGG + Intergenic
963026867 3:140928236-140928258 ATATATATCCTAAAGGTTTTGGG + Intergenic
964032957 3:152160553-152160575 ATCTAGAAACTAAAAATTCTAGG + Intergenic
965369730 3:167846680-167846702 ATCTATAAAGTAAACTTTCTGGG + Intergenic
965932024 3:174056103-174056125 ATGTATAACCTAAAGCTTAGAGG + Intronic
966316606 3:178654022-178654044 ATCTATAACCTAAAGCTTCTAGG - Intronic
966532321 3:180994629-180994651 ATTTATAAAATAAAGCTTCTGGG - Intergenic
968172714 3:196523340-196523362 ATCGATAACCTAAAGATGCAGGG + Intergenic
970593902 4:17582669-17582691 ATCTATACACTACAGGTTCTGGG - Intronic
970891613 4:21051782-21051804 ATATTTAACCAGAAGCTTCTTGG - Intronic
974194460 4:58554038-58554060 ATCTATAACCTAAAGCATGTTGG - Intergenic
975901804 4:79162234-79162256 ATGTATTTCCAAAAGCTTCTAGG + Intergenic
977270389 4:94910834-94910856 CTCTATAACCTCAAACTCCTGGG - Intronic
977706558 4:100077463-100077485 ATCTTTAATCTAATGCTTCAAGG - Intergenic
980239419 4:130154078-130154100 ATCTTTATCCTAAAGGTTTTAGG - Intergenic
980326311 4:131351846-131351868 ATCTGTACACTTAAGCTTCTAGG - Intergenic
981245285 4:142529634-142529656 ATCCATAAACAAAAGCTTTTTGG + Intronic
981371042 4:143959196-143959218 ATCTACAACCTCAAGTTTATTGG - Intergenic
983351335 4:166594205-166594227 ATCAATAAGCTAAACCATCTGGG + Intergenic
984082746 4:175268812-175268834 TTCTATAACCTAAAACTTGCGGG - Intergenic
985042978 4:185910751-185910773 TTCTATAACCTAAATCCTGTGGG + Intronic
988423492 5:31035370-31035392 ATCTTTAAGATAAAGATTCTAGG + Intergenic
990270715 5:54135324-54135346 ATCTATAGCATCATGCTTCTAGG + Intronic
990930584 5:61086041-61086063 CACTATAACCTCAAACTTCTGGG - Intronic
993904423 5:93607160-93607182 AACTACAAAATAAAGCTTCTGGG - Intergenic
994184968 5:96807340-96807362 GTCTTTAACCCAAAGCCTCTGGG + Intronic
996926506 5:128833152-128833174 ATATATAGCCTACTGCTTCTAGG - Intronic
998156617 5:139790390-139790412 AGCTAAACCCTGAAGCTTCTCGG - Intergenic
1000948277 5:167449129-167449151 ATGTAAAAGCTAAAGCTTGTAGG + Intronic
1001264818 5:170266459-170266481 CTCTGTACCCTAAAGCCTCTTGG + Intronic
1001660686 5:173390444-173390466 ATCCAAAACCTACAGCTACTTGG - Intergenic
1001826901 5:174752316-174752338 AGCTGTAGCCTAATGCTTCTAGG + Intergenic
1003207392 6:4025672-4025694 ATCTAGCTCCTAGAGCTTCTGGG - Intronic
1003596453 6:7478409-7478431 CTCTATAACCTCAAACTCCTGGG - Intergenic
1005703415 6:28427490-28427512 GTGTATAACCTAATGCTCCTAGG + Intergenic
1006422237 6:33942282-33942304 TTCTATAACCAAAATCTTCCAGG + Intergenic
1008000114 6:46351533-46351555 AGCTAGAAGATAAAGCTTCTTGG - Intronic
1008081883 6:47203729-47203751 ATATGTACCCTGAAGCTTCTTGG + Intergenic
1008144166 6:47870259-47870281 ATCTATTATCTAAAGCTTACAGG - Intergenic
1008441413 6:51535966-51535988 ACTAATGACCTAAAGCTTCTTGG - Intergenic
1009197011 6:60698805-60698827 TTATATAACCTACAGTTTCTTGG + Intergenic
1009822797 6:68826387-68826409 ATCTATACCCTAACACTTCAGGG - Intronic
1010217412 6:73416376-73416398 ATCTATTACTTAATCCTTCTGGG + Intronic
1012125508 6:95423425-95423447 AGCTATTACTTAGAGCTTCTGGG + Intergenic
1012177820 6:96110729-96110751 ATCTATAACCTCAAACTCCTGGG + Intronic
1013298355 6:108780403-108780425 ATCTATAAAATAAAGCCTCAGGG - Intergenic
1018177903 6:161194329-161194351 ATCTAAAAGATAAAGCTTCTTGG + Intronic
1020058390 7:5134415-5134437 ATCTATAAACAAAAAATTCTGGG + Intergenic
1023160165 7:37289206-37289228 ATCTATAAACTAAAGCTCACTGG + Intronic
1024582881 7:50814345-50814367 AGCTTTACCCTAAAGCTTATCGG + Intergenic
1024712758 7:52035623-52035645 ATCAATAACCGAAAGCTATTTGG + Intergenic
1026349953 7:69507131-69507153 TTCTTTAACGTAAAGATTCTAGG - Intergenic
1026618018 7:71924511-71924533 ATCTATAACTTCAAGCGTATTGG - Intronic
1032272082 7:130418509-130418531 ACATATAACCTAAAGCTACTGGG - Intronic
1032310477 7:130781603-130781625 ATTTATTACTTAAAGATTCTGGG - Intergenic
1032323668 7:130906747-130906769 AACTACAGCCTCAAGCTTCTGGG + Intergenic
1035887949 8:3312402-3312424 CTCTATAACTTAAAGCCTCTAGG + Intronic
1037460791 8:19107166-19107188 CACTACAACCTCAAGCTTCTGGG + Intergenic
1041182317 8:55261474-55261496 ATCTTTGACCTAAACCTTGTTGG - Intronic
1042089441 8:65142897-65142919 ATCTATCACCTATCTCTTCTTGG - Intergenic
1044114750 8:88321720-88321742 CTACATAAACTAAAGCTTCTAGG + Intronic
1044480380 8:92680569-92680591 CACTATAGCCTCAAGCTTCTGGG - Intergenic
1050594096 9:7188678-7188700 ATCTCTGACCTAAAGCTATTTGG + Intergenic
1051885195 9:21885352-21885374 TACTATAACCTAAAGGTTCTGGG + Intronic
1052544562 9:29858462-29858484 ATCTATAATGTAATGTTTCTTGG + Intergenic
1060158232 9:121335222-121335244 ATTTACCACCCAAAGCTTCTAGG + Intergenic
1060453527 9:123766449-123766471 ATCTATCTCCTAGAGCTTCTAGG + Intronic
1186695360 X:12025066-12025088 CTCTATAACCTCAAGAGTCTTGG + Intergenic
1190724275 X:53177303-53177325 AACTGTAACCTCAAGCTTCTGGG - Intergenic
1193988242 X:88273657-88273679 TTCTCTAACCTAAAGAATCTTGG + Intergenic
1194641826 X:96412044-96412066 ATATAAAACCTAAATCTACTGGG + Intergenic
1196067661 X:111482878-111482900 ATTTAAAACCTAATGCTTCAAGG - Intergenic
1198126624 X:133650587-133650609 ATCTAAATTCTAAAGATTCTTGG - Intronic
1198736395 X:139790151-139790173 CACTATAACCTCAAACTTCTTGG + Intronic
1199446268 X:147926077-147926099 ATGTATAAACTAAAGCTTGTAGG - Intronic