ID: 966316873

View in Genome Browser
Species Human (GRCh38)
Location 3:178657185-178657207
Sequence TTTGTGGGGATCGTAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966316873_966316878 -2 Left 966316873 3:178657185-178657207 CCTGCTGCTACGATCCCCACAAA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 966316878 3:178657206-178657228 AAAGAGGTCCTGCACCACACAGG 0: 1
1: 0
2: 0
3: 13
4: 168
966316873_966316882 30 Left 966316873 3:178657185-178657207 CCTGCTGCTACGATCCCCACAAA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 966316882 3:178657238-178657260 AGTTCATTTCTTCAGGCTGCTGG 0: 1
1: 0
2: 1
3: 24
4: 214
966316873_966316881 23 Left 966316873 3:178657185-178657207 CCTGCTGCTACGATCCCCACAAA 0: 1
1: 0
2: 1
3: 8
4: 79
Right 966316881 3:178657231-178657253 AGCTCTGAGTTCATTTCTTCAGG 0: 1
1: 0
2: 4
3: 31
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966316873 Original CRISPR TTTGTGGGGATCGTAGCAGC AGG (reversed) Intronic
900371967 1:2336212-2336234 GTTGTGGTGATCGAAGCAGATGG + Intronic
903196475 1:21692720-21692742 GTTGTGAGGATGGTAGCAGAAGG + Intronic
904330746 1:29756355-29756377 GTTGTGGGGATCCGTGCAGCAGG + Intergenic
922971768 1:229747682-229747704 TTTGTTGGGGTGGTAGCAGCAGG + Intergenic
923504985 1:234597814-234597836 TATGTGTGGCTGGTAGCAGCTGG - Intergenic
1077311267 11:1890014-1890036 TGTGTGGGGATGGTGCCAGCTGG + Exonic
1079112806 11:17614327-17614349 TTTGTGGTGCTCTTAGGAGCGGG + Intronic
1081439615 11:43065740-43065762 TTTGTGGGGAGCCTTGAAGCAGG + Intergenic
1084054868 11:66625633-66625655 TTTGTAGGGATCGTCGTAGCTGG - Exonic
1085096442 11:73764214-73764236 TTAGTGGGGATGGGAGCAGATGG - Intergenic
1088824493 11:113482537-113482559 TTTGTGGGGGTCATACCAGGGGG + Intergenic
1096577971 12:52566416-52566438 TTTGTGGAGATGGGTGCAGCTGG + Exonic
1096984178 12:55745448-55745470 TTTGATGGGATCCTACCAGCTGG - Intronic
1100430519 12:94528358-94528380 TTTGTGGGGAGCGGGGGAGCGGG - Intergenic
1104840709 12:131824001-131824023 TTGGTGGTGTTCGTGGCAGCAGG + Intergenic
1106213653 13:27674445-27674467 TCTCTGGGGAGCTTAGCAGCAGG - Intergenic
1109322318 13:60826127-60826149 TTTTTGGGCATCTTGGCAGCAGG + Intergenic
1114868111 14:26622739-26622761 TTTGTGGGGATCTTAGGATGTGG + Intergenic
1119262786 14:73247534-73247556 GTTGTGGGGATCGTGGCTGTGGG + Intronic
1119262806 14:73247680-73247702 GTTGTGGGGATCGTGGCTGTGGG + Intronic
1119262865 14:73248119-73248141 GTTGTGGGGATCGTGGCTGTGGG + Intronic
1124845306 15:33284204-33284226 TTAGTGGGGATGTAAGCAGCAGG + Intergenic
1125855435 15:42944774-42944796 TTTGTGGTGATAGCAGCAGGTGG + Exonic
1136285890 16:29241548-29241570 TTTGTGGAGATCACAGCAGCTGG - Intergenic
1142091230 16:88211734-88211756 TTTGTGGAGATCACAGCAGCTGG - Intergenic
1144182577 17:12766447-12766469 TTTGTGGAGACTGTAGAAGCAGG - Exonic
1144824559 17:18098508-18098530 CTTCTGGGGATCCTAGCTGCTGG + Intronic
1149021410 17:51969767-51969789 TTTGTGGGGATCTTATGAGTAGG + Intronic
1158929167 18:62304280-62304302 TTTGTGGGAAGAGAAGCAGCAGG + Intronic
1159293993 18:66457378-66457400 AGTGTGGGGATAGTAGCAGTAGG - Intergenic
1159634194 18:70785363-70785385 CTTGAGGGGATCCTATCAGCAGG + Intergenic
1160102665 18:75937766-75937788 TTTTAGGGGATCTTAACAGCTGG + Intergenic
1165047518 19:33117408-33117430 TTTTTGGGGATCCTAGTAGCTGG + Intronic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
926944523 2:18172320-18172342 TGTGTGGGGATTGTAGGAGTAGG + Intronic
927296515 2:21460721-21460743 TTTGTAGGGTTGGTAGCAGCAGG + Intergenic
934863136 2:97781015-97781037 TGTGTGGAGATCGTGGGAGCAGG - Intronic
935329084 2:101963155-101963177 TTTGTGGGACTCTGAGCAGCTGG + Intergenic
935646808 2:105343718-105343740 TTTGTGGGGATAGCAGAAGTTGG + Intronic
938261106 2:129895660-129895682 TTGGTGGGGACCAGAGCAGCTGG + Intergenic
939048137 2:137274064-137274086 TTTTTGGGGAACGTGGCAGGAGG - Intronic
943914721 2:193615418-193615440 TTTCTGGGGATCATAGCATTAGG + Intergenic
945406151 2:209451413-209451435 ACTGTGGGAATCTTAGCAGCAGG - Intronic
946766996 2:223050165-223050187 TATGTGGGAATCGGGGCAGCAGG + Intergenic
1171258909 20:23713706-23713728 TTGGTGGGGATAGTGGCAACTGG + Intergenic
1171267707 20:23785771-23785793 CTTGTGGGGATGGTGGCAACTGG + Intergenic
1171802357 20:29635638-29635660 TTTGTGGAGACCATAGCAGTGGG - Intergenic
1173541710 20:43857500-43857522 TTTATGGGGAACCTAGCAGAAGG + Intergenic
1180637199 22:17270586-17270608 TTTGTGGAGAGGGTAGAAGCTGG - Intergenic
1182757532 22:32691800-32691822 TTGGTGGGTATCTTAGCAGGTGG - Intronic
1183601154 22:38841362-38841384 GTTGGGGGGATCCTGGCAGCTGG - Intronic
1184424918 22:44403620-44403642 TCTGTGGGGATAGTGGCAGTGGG + Intergenic
950854895 3:16095708-16095730 GTGGTGGGGATCTTAGCAACTGG + Intergenic
956564886 3:70625164-70625186 TCTGTGGGGATAGAAGCAGATGG + Intergenic
959837632 3:110939161-110939183 TTCCTGGGGATGGAAGCAGCTGG - Intergenic
966316873 3:178657185-178657207 TTTGTGGGGATCGTAGCAGCAGG - Intronic
967536498 3:190609849-190609871 TTTGTGGGGAAGGAAGCAGATGG + Intronic
970956311 4:21815859-21815881 TTTCTGGAGATCATACCAGCTGG - Intronic
990168070 5:53017526-53017548 TTTGTTGGGGTGGTGGCAGCAGG + Intronic
992895696 5:81243321-81243343 TTTGTGGGGATTGAGGCACCAGG + Intronic
998947229 5:147352787-147352809 TTTCTGGGGATCATAGCAGCAGG + Intronic
1006473562 6:34241559-34241581 TTTGTGGGGAGAGCAGCACCAGG - Intronic
1009435335 6:63611062-63611084 ATTGTTGAGATCTTAGCAGCAGG + Intergenic
1010177946 6:73051420-73051442 TTTGTTGGGGTGGTGGCAGCAGG - Intronic
1010855570 6:80834303-80834325 TTTGTGGGGAGCGTAGGATGGGG + Intergenic
1017684904 6:156902769-156902791 TCTGTGGGGTTTGTAGCAGTAGG + Intronic
1019414500 7:921044-921066 TTTGGGGTGATCGTTGTAGCAGG - Intronic
1020651674 7:10883776-10883798 TTTTTGGGAATAGTATCAGCAGG + Intergenic
1025623948 7:63201378-63201400 TTTGTGGGGTTCCTAAGAGCAGG + Intergenic
1028397840 7:90391919-90391941 TTAGTGGTGATGGTAGGAGCGGG + Intronic
1033116108 7:138626873-138626895 TTCCAGGGGATGGTAGCAGCAGG - Intronic
1034234538 7:149556484-149556506 TTTGTGGTGACAGGAGCAGCTGG - Intergenic
1040962698 8:53051786-53051808 TTTGTTGGGATGGTGGTAGCAGG + Intergenic
1041470048 8:58198225-58198247 TTTGTGGGGAAAATAGCAGGAGG + Intronic
1042591030 8:70399033-70399055 TTTGTGGGTATTTTAGAAGCTGG - Intronic
1045322242 8:101091069-101091091 TTTGAGGGGAAAGTATCAGCAGG - Intergenic
1048872237 8:138809160-138809182 TTTGTGGGGAGGGAAGCAGCAGG + Intronic
1052320377 9:27161127-27161149 TTTGGGGGGATCATTACAGCGGG - Intronic
1053540371 9:38967566-38967588 TTTGAGGTAATCTTAGCAGCAGG - Intergenic
1053804718 9:41789724-41789746 TTTGAGGTAATCTTAGCAGCAGG - Intergenic
1054625772 9:67396357-67396379 TTTGAGGTAATCTTAGCAGCAGG + Intergenic
1054818955 9:69502818-69502840 TTTGTGGGAAGGATAGCAGCAGG - Intronic
1055831977 9:80390571-80390593 TTTGTGGGGAGTGGGGCAGCGGG + Intergenic
1062426540 9:136508716-136508738 TTTCTGGGGATCTGAGCAGCCGG - Intronic
1062442684 9:136578233-136578255 TTTGTGGGGATTTCAGCAGGAGG - Intergenic
1189841486 X:45083500-45083522 TTTGTGCGTGTCGTATCAGCAGG + Exonic
1191033911 X:56005302-56005324 TTTGTCGGGATGGTGGCAGTGGG + Intergenic
1192177908 X:68897427-68897449 CTGGTGGGGATGGGAGCAGCAGG - Intergenic
1192260350 X:69502729-69502751 TTTGTGGGGAAGGGAGTAGCAGG - Intergenic