ID: 966321604

View in Genome Browser
Species Human (GRCh38)
Location 3:178707078-178707100
Sequence AAGTGGAGACAGAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1338
Summary {0: 1, 1: 1, 2: 7, 3: 148, 4: 1181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966321604 Original CRISPR AAGTGGAGACAGAAGGAGAA AGG Intronic
900666577 1:3819606-3819628 GACTGGAGATGGAAGGAGAAAGG + Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900967863 1:5971840-5971862 CACTGGAGACAGAGGGAGACGGG + Intronic
901154335 1:7125377-7125399 ATGGGGAGACAGAAGTAGATAGG + Intronic
901514340 1:9734964-9734986 AAGTGGAGCCTGAAGGGGACGGG - Exonic
901625617 1:10623189-10623211 GAGTGGAGACAGAGGGAGAGGGG - Intronic
901639914 1:10687967-10687989 TAGTGGGGGCAGAAGGAGGAAGG - Intronic
901698291 1:11027647-11027669 AACTGGAGAAAGAAGCAGATAGG + Exonic
901739827 1:11334777-11334799 AACTGTGGACAGAAGGAGAGCGG + Intergenic
901755976 1:11441841-11441863 GAGAGGAGACAGGAGGAGAGAGG + Intergenic
901798962 1:11696215-11696237 AAGGGGAGACAGAGGGAGTAAGG - Intronic
902278763 1:15359174-15359196 AAGAGGAGACAAGAGGAGTAAGG + Intronic
902645181 1:17792897-17792919 GAGTGGAGACAGGAGGACATAGG + Intronic
902699825 1:18164275-18164297 AAGGGGAGAGGGAAGGAGCAAGG - Intronic
902774724 1:18667373-18667395 AAGGAGAGAAGGAAGGAGAAAGG + Intronic
903108466 1:21106534-21106556 AAGTTGAAATAGAAGTAGAAAGG + Intronic
903165329 1:21516214-21516236 AGGTGGAGACAGGTGGAGACAGG - Intronic
903321838 1:22547968-22547990 AGATGGAGAGAGAAGGAGAGAGG - Intergenic
903365774 1:22804781-22804803 AAGAGGACACTGAAGGAGCAGGG - Intronic
903583274 1:24388271-24388293 AAGTGGAGACAGAAACAGGGAGG + Intronic
903883091 1:26525432-26525454 AGGCTGAGGCAGAAGGAGAATGG + Intergenic
904083266 1:27885476-27885498 GAGGGGAGACACAAGGACAAGGG - Intronic
904196206 1:28787483-28787505 AAGTGGAGACAGGAGGCAAGAGG + Intergenic
904361313 1:29974103-29974125 TAGTGGGGACAGGAGAAGAAAGG + Intergenic
904596610 1:31650292-31650314 AAATGAAGACAGAAGGATAATGG + Intergenic
904639390 1:31912500-31912522 AGGTGAATACAGAAAGAGAAAGG - Intronic
904761489 1:32807843-32807865 ATGAAGAGACTGAAGGAGAATGG - Intronic
904851463 1:33462798-33462820 GGATGGAGACAGAAAGAGAAAGG + Intergenic
905039334 1:34941421-34941443 AAGTGGAAAAAGTAGGGGAAAGG + Intergenic
905278712 1:36835516-36835538 ATGTGGAGAAGGAAGGAGGAAGG - Intronic
905420969 1:37843839-37843861 GAGGGGAGACAGGAGGAGTAGGG - Intronic
905714298 1:40134869-40134891 AAGGAGACAGAGAAGGAGAAGGG - Intergenic
906550077 1:46657810-46657832 GAGTGGAAAAAAAAGGAGAAGGG + Intronic
906644350 1:47463128-47463150 AAGTGGAGACGGTAGTGGAAGGG + Intergenic
906735818 1:48126045-48126067 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
906859304 1:49341877-49341899 AAGGAGAGAGAGGAGGAGAAAGG - Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907394291 1:54178531-54178553 ATGTGGAGTCAGAGGGAGGAGGG + Intronic
907422570 1:54357133-54357155 GAGAGGAGACAGAAGGCCAAAGG + Intronic
907888926 1:58619768-58619790 AAGTGGAGACAGGAGAAGAAGGG + Intergenic
908528265 1:65008670-65008692 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
908855496 1:68422421-68422443 AGGTAGAGACAGAGGAAGAAGGG - Intergenic
909252389 1:73375447-73375469 AAGTGGTAACAGAAGGACACGGG - Intergenic
909364382 1:74802252-74802274 TATTGGAGAAAGAAGGAGAAAGG - Intergenic
909700386 1:78514862-78514884 GAGGGGAGCAAGAAGGAGAAGGG - Intronic
910049148 1:82956217-82956239 AGGTAGAGACAGAGAGAGAAGGG - Intergenic
910276165 1:85451266-85451288 AAGAGAAGATAGCAGGAGAAGGG + Intronic
910336598 1:86139159-86139181 AAGATGAGGGAGAAGGAGAAAGG + Intronic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
912248793 1:107989771-107989793 AAGGGTAGACAGTGGGAGAAGGG + Intergenic
912370235 1:109168062-109168084 AAGTGAAGACAGAAGGAACTTGG - Intronic
912520836 1:110243621-110243643 AAGAGGAGGAAGAGGGAGAAGGG + Intronic
912560555 1:110548428-110548450 AAGGACAGAGAGAAGGAGAAGGG + Intergenic
912567329 1:110597469-110597491 ATGGGGAGACAGAGGGAGAGGGG + Intronic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
912860775 1:113211815-113211837 AAGTGGGGAGAAGAGGAGAAGGG + Intergenic
912917106 1:113826383-113826405 AAGTGAAGGGAGAAGGGGAAGGG + Intronic
913147817 1:116009451-116009473 AAGGAGAGACAGCAGCAGAATGG + Intronic
913255639 1:116950695-116950717 CAGTGGAGACAGAGGGGGCAGGG + Intronic
913485926 1:119332837-119332859 ATGTGGAGGGGGAAGGAGAAAGG - Intergenic
913709345 1:121466177-121466199 ACGTGGAGACTGTGGGAGAAAGG + Intergenic
913993344 1:143635140-143635162 AAGAGGAGAAAGCAGGTGAAAGG + Intergenic
914086186 1:144456165-144456187 AAGAGGAGAAAGCAGGTGAAAGG + Intronic
914192080 1:145420116-145420138 AAGAGGAGAAAGCAGGTGAAAGG + Intergenic
914444140 1:147735450-147735472 AGATGGAAACAGAAGCAGAATGG + Intergenic
914589987 1:149098066-149098088 AAGAGGAGAAAGCAGGTGAAAGG + Intronic
914734586 1:150403147-150403169 ATGTAGAGAAAGAAGGTGAAGGG - Intronic
914922652 1:151858055-151858077 AAATTCATACAGAAGGAGAAGGG - Intergenic
915128953 1:153683975-153683997 CAGAGGAGAAAGAAAGAGAAGGG + Intronic
915548313 1:156616386-156616408 CAGTGAGGACAGAATGAGAAAGG - Intergenic
915624607 1:157106971-157106993 CAGTGGAGACAAGAGGAGAAGGG - Intergenic
915656514 1:157365359-157365381 GAGAGGACAGAGAAGGAGAAAGG + Intergenic
915664785 1:157434547-157434569 AAAGAGAGAAAGAAGGAGAAGGG - Intergenic
915672772 1:157504212-157504234 GAGAGGACAGAGAAGGAGAAAGG - Intergenic
915685615 1:157629868-157629890 TATTGGAGACAGAAAGAGGAGGG - Intergenic
915730448 1:158050073-158050095 AAGTGGAGACTGGAGGAGAGAGG + Intronic
915744199 1:158143508-158143530 AAGGGAAAACAGAAGAAGAATGG + Intergenic
916069505 1:161161648-161161670 AATTGGAGCCAGCAGGAGAAGGG + Intronic
916149333 1:161771129-161771151 AAGAGAAGAGAGAAGGAGAGAGG - Intronic
916820543 1:168393978-168394000 CAGGGGAGAAAAAAGGAGAATGG + Intergenic
917307272 1:173639474-173639496 AAGAGAACACAGAAGGAAAATGG + Intronic
918107177 1:181425232-181425254 AAGCGAAGCCAGGAGGAGAAGGG + Intronic
918146941 1:181765326-181765348 GAGTGGAGACAGTAGAATAAGGG + Intronic
918184917 1:182118585-182118607 AGGAGGAGACAGAGAGAGAAAGG + Intergenic
918460308 1:184769730-184769752 AAGTGGAAAGAGAAAGAGGAAGG + Intergenic
918483859 1:185008451-185008473 ATGTTGAGATAGAAAGAGAATGG - Intergenic
918660470 1:187081792-187081814 AAGATGAGAGAGAAGGAAAAGGG - Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919518187 1:198553686-198553708 AATTGGAGACAGAAGAATAAGGG - Intergenic
919617010 1:199820430-199820452 AGGGAGAGACAGAAGGACAATGG + Intergenic
920040153 1:203090283-203090305 TAGAGGAGCAAGAAGGAGAAGGG + Intergenic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920360569 1:205412836-205412858 AAGTGGAGACCGAAGGCCACTGG + Intronic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
920823675 1:209404316-209404338 AAGGGGAGAGAGGAGCAGAAAGG + Intergenic
921141004 1:212306192-212306214 AAGTGGAGAGAATAGGGGAAGGG + Intronic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921805407 1:219448568-219448590 AGGTGTAGACAGATGGACAATGG - Intergenic
921819117 1:219596443-219596465 AAGAGGAGTGAGAAGGGGAAAGG + Intergenic
921970730 1:221146512-221146534 AAGGAGAGAGAGAAGGAGATCGG - Intergenic
922204666 1:223436053-223436075 AAGAGGAAAAAGCAGGAGAAGGG + Intergenic
922331274 1:224578801-224578823 AAGAGGAGAAAGACGGAGAAGGG - Intronic
922383191 1:225054126-225054148 AGTAGGAGACAGAAGGAGAGAGG - Intronic
922598445 1:226832086-226832108 AAGTTGGGACAGAAGGAAGATGG + Intergenic
922964987 1:229682039-229682061 AAGAGAAGAAAGAAGGAGAGAGG - Intergenic
923051323 1:230393097-230393119 AAGGGGAAAAAGAAGGGGAAGGG + Intronic
923267157 1:232325902-232325924 AAGAGGAGGAGGAAGGAGAAAGG + Intergenic
923294015 1:232575416-232575438 AAATGGAGACAGATTGAAAAAGG - Intergenic
923618490 1:235557528-235557550 ATGTGTAGACAGAAGGGGATTGG - Intronic
923725942 1:236505520-236505542 AAGTGGAGACAAGATGTGAAGGG - Intergenic
923980193 1:239312835-239312857 AAGAGGCGAAAGATGGAGAATGG + Intergenic
924368682 1:243323500-243323522 CAGTGGAGAGAAAAGGATAAAGG - Intronic
924868577 1:248014273-248014295 AAGTAAAGACAGAATGAGAGTGG + Intronic
924905497 1:248447611-248447633 AACTCGAGACTGAAGGAGAGAGG - Intergenic
924922394 1:248644423-248644445 AACTCGAGACTGAAGGAGAGAGG + Intergenic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063625939 10:7690081-7690103 AAGAGGAGACAAAAAGACAAAGG - Intergenic
1063736853 10:8766782-8766804 AAGTGAAGACGGAGGGAGGAAGG - Intergenic
1063938079 10:11099560-11099582 AAGTGGAAACAGAAGGAAATCGG - Intronic
1064053416 10:12077872-12077894 AGGTGGAGACAGAGAGGGAAGGG + Intronic
1064322382 10:14317708-14317730 GAGGGGAGAGGGAAGGAGAAAGG + Intronic
1064535885 10:16357403-16357425 AACTGGACACAGCAGAAGAAAGG - Intergenic
1064805681 10:19128853-19128875 AAGGAGAGAGAGAAGAAGAATGG - Intronic
1064926875 10:20579161-20579183 AAGTGGAGATGGAAGCAGAATGG - Intergenic
1065082842 10:22144204-22144226 AAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1065494979 10:26318554-26318576 AAGGAGAGAAAGAGGGAGAAAGG + Intergenic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065761576 10:28987780-28987802 AAGAGGAGAAGGAAGGAGAAAGG - Intergenic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1066284098 10:33947218-33947240 AACTGGAGTCTTAAGGAGAAGGG - Intergenic
1066334512 10:34462865-34462887 AAGAGGAAAGAGAAGGGGAAGGG + Intronic
1066592986 10:37016117-37016139 AAGTGAAGACAGAGAGAGAAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067314128 10:45145280-45145302 AGAAGGAGACAGAGGGAGAAGGG + Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1068086637 10:52381696-52381718 CAGTGGAGAAAGAAGGACAGAGG + Intergenic
1068510095 10:57954901-57954923 AAGGTGAGTGAGAAGGAGAATGG + Intergenic
1068519710 10:58064801-58064823 AAGAGGAGACAGAGAGAAAAGGG - Intergenic
1068625065 10:59235720-59235742 AAGTGGAGAGTGAAGAAAAAGGG - Intronic
1068632765 10:59314662-59314684 AAGGGGAGAAAGATTGAGAAGGG - Intronic
1068895498 10:62195479-62195501 AAGGAGAGACAGAAGGAAAGTGG + Exonic
1069654819 10:70079953-70079975 ACTTGGAGACAAAAGGAGTAGGG + Intronic
1069726107 10:70580152-70580174 GATGGGAGACAGAAGGAGGAAGG - Intergenic
1069835432 10:71305019-71305041 AAGTAGAGACAGAGGAAGGAGGG - Intergenic
1070457487 10:76631793-76631815 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1070518083 10:77226420-77226442 CAGTGAAGACAGAAAGAGACAGG - Intronic
1071877757 10:89861295-89861317 AAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1072231040 10:93414211-93414233 GGGAGGACACAGAAGGAGAAAGG - Intronic
1072247259 10:93554743-93554765 AAGCAGAGCCACAAGGAGAAGGG - Intergenic
1072269573 10:93762940-93762962 AAGTGGAGAGTGAAAGAGAGGGG - Intronic
1072340177 10:94439652-94439674 AAAGGGACACTGAAGGAGAAAGG - Intronic
1072491675 10:95912542-95912564 AAGTGGCCACAGAGGTAGAAGGG + Intronic
1072511887 10:96135225-96135247 AAGTGAAGCCATAAGGAGATGGG + Intronic
1072802704 10:98404466-98404488 ATGTGGAGTCTGAATGAGAAGGG + Intronic
1073112602 10:101071578-101071600 AAGAGGACACAGAAGAAGGAAGG - Intergenic
1073152771 10:101323104-101323126 AAGTGGAGGCAGAGGGAGGTAGG + Intergenic
1073331678 10:102674142-102674164 AAGTGGAGACGGAGGGAGGGAGG + Exonic
1073597737 10:104817443-104817465 GAGAGGAGGAAGAAGGAGAAGGG - Intronic
1073764313 10:106665350-106665372 AAGGGAAGGAAGAAGGAGAAAGG - Intronic
1074004639 10:109408103-109408125 AAGTGGGGAAAGAACGAGTAAGG + Intergenic
1074204658 10:111272271-111272293 AAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1074403427 10:113161104-113161126 GAGTCGAGACACATGGAGAAGGG + Intronic
1074596792 10:114875361-114875383 AAGTGAAGAAAGAAGAAGCAAGG + Intronic
1074672285 10:115805383-115805405 AAATGGTGACAGAGAGAGAATGG - Intronic
1074917868 10:117975023-117975045 AAGTAAAAATAGAAGGAGAAGGG + Intergenic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075945829 10:126432352-126432374 AAATGTAGAAGGAAGGAGAAAGG - Intronic
1075959933 10:126559593-126559615 AGGCGGAGGCAGAAGGTGAAAGG - Intronic
1076121404 10:127939798-127939820 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121417 10:127939858-127939880 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1076121429 10:127939918-127939940 AGGTGGAGGCAGGAGGAGACAGG + Intronic
1077554895 11:3221159-3221181 GAGGGGAGGGAGAAGGAGAATGG + Intergenic
1078084415 11:8225100-8225122 GTGGGGAGACAGATGGAGAAAGG + Intronic
1078096788 11:8302440-8302462 GAGGGGAGAGAGAAGAAGAAAGG + Intergenic
1078391444 11:10938665-10938687 AAGAGGAAAAAGAAGGGGAAGGG - Intergenic
1078407578 11:11084049-11084071 AATTGGAAAAAGAAAGAGAAAGG - Intergenic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078822515 11:14895962-14895984 AAGAGGATGCAGAAGGGGAAAGG + Intergenic
1079341976 11:19618811-19618833 AAGTGGAGTAAGAAGGAAGATGG + Intronic
1079407545 11:20159306-20159328 GAGGGGGGACAGAAGGAGAGAGG + Intronic
1079600492 11:22305995-22306017 AGGTGAAGTCAGAAGCAGAATGG - Intergenic
1080047330 11:27822458-27822480 AAGGAGAGAGGGAAGGAGAAAGG - Intergenic
1080113397 11:28595168-28595190 ATGAGGAGACAGAATCAGAATGG - Intergenic
1080157406 11:29127913-29127935 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
1080344648 11:31310982-31311004 AGGTAGACACAGAAGGAGATAGG - Intronic
1080352488 11:31401448-31401470 AAGAGGAGACAGCGGGAGAAGGG - Intronic
1080397878 11:31906596-31906618 AGGGAGAGACAGAAAGAGAAGGG + Intronic
1080812996 11:35724473-35724495 AACCGTAGACAAAAGGAGAAAGG - Intronic
1080885785 11:36366874-36366896 AAGGGGAGAAAGAAGGAGAGAGG - Intronic
1080925904 11:36755591-36755613 AAGTGGAGGCAGGTGGAAAAGGG - Intergenic
1080945121 11:36964139-36964161 AAGAAGACACAAAAGGAGAATGG + Intergenic
1081156866 11:39703941-39703963 AAGAGGAGAGAGAAAGAGAGAGG - Intergenic
1081698095 11:45132619-45132641 GAATGGAAACAGAAGTAGAAAGG - Intronic
1081751422 11:45513867-45513889 AAGTGAAGGCAGAGGGAGGAAGG + Intergenic
1081826121 11:46053987-46054009 AAGTGGGGGCAAAAGAAGAAAGG - Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1082655431 11:55850481-55850503 CAGTGAAGTCAGAAGGTGAACGG + Intergenic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082919631 11:58479179-58479201 TAGTTGAGACAAAAAGAGAAAGG + Intergenic
1083142523 11:60733703-60733725 AAGTGGAGGAAGAAGGAGCATGG + Intronic
1083433926 11:62629975-62629997 AAATGGGGACAGAAGGACAGAGG + Intronic
1083487130 11:62990284-62990306 AAGAGGAAAGAGAATGAGAAGGG - Intronic
1083642701 11:64153956-64153978 AAGTGGAGACAGCAGAGGAGGGG - Intronic
1083743333 11:64722500-64722522 AAGTGGAGAGGGAAGGAAAGGGG - Intronic
1083914625 11:65733186-65733208 GAGTGGAGACAAAAACAGAATGG + Intergenic
1084010077 11:66342943-66342965 AAGAGGAAGCAGAAGGAGATGGG - Intronic
1084182912 11:67455541-67455563 AAGAGGAGCAAGAAGGAGAGGGG + Exonic
1084245746 11:67855931-67855953 GAGTAGAGACACAAAGAGAAGGG + Intergenic
1084826939 11:71738647-71738669 GAGTAGAGACACAAAGAGAAGGG - Intergenic
1085056740 11:73409005-73409027 GAGTGGAGACAGGATTAGAAGGG - Intronic
1085262905 11:75218507-75218529 GAGTGAATGCAGAAGGAGAAAGG + Intergenic
1085843220 11:80037563-80037585 AAATGGAGGAAGAAAGAGAATGG - Intergenic
1085844106 11:80046044-80046066 AAGTGGAGAAAGATGGTTAACGG - Intergenic
1085978333 11:81689771-81689793 AAATGGAGAAAAAAGAAGAAAGG - Intergenic
1086457102 11:86969774-86969796 AAATGGAGACAGCAAGAGAAAGG + Intergenic
1086457398 11:86972736-86972758 AAAGGGAGAAAGAAAGAGAAAGG - Intergenic
1087051978 11:93895648-93895670 AACAGGAGCAAGAAGGAGAAGGG + Intergenic
1087422100 11:97942544-97942566 ATGTGAAGACAGAAACAGAATGG + Intergenic
1087675122 11:101152702-101152724 AACTGGAGAGAGGAGGGGAAAGG - Intergenic
1087679364 11:101202346-101202368 GAGTGGAGGCAGAAGGAGCCAGG - Intergenic
1087732074 11:101790223-101790245 AAGAAGAGGAAGAAGGAGAAAGG + Intronic
1088211061 11:107456841-107456863 AATTGGAGATTAAAGGAGAATGG + Intronic
1088257748 11:107916796-107916818 ATGTGGAGCCAGAAGGAGGATGG - Intronic
1088466731 11:110147701-110147723 AAGGGGAGGCAAAAGGAGTAAGG - Intronic
1088549029 11:110991645-110991667 AAGGTGAGAGAGAAGGAGATCGG + Intergenic
1088613134 11:111598454-111598476 AAGAGGAGAAAGAGGGAGAGAGG + Intergenic
1088940593 11:114451360-114451382 TAGTGGACTGAGAAGGAGAAAGG - Intergenic
1089042231 11:115462890-115462912 AAGGGGAGAAAGAAGGAAAGGGG + Intronic
1089044601 11:115489502-115489524 AAGTTGTGACAGAAGTTGAAAGG + Intronic
1089330239 11:117684273-117684295 GTGGGGAGAAAGAAGGAGAAGGG - Intronic
1089333979 11:117709877-117709899 AGGTCCAGACAGAAGGAGCAGGG + Intronic
1089493582 11:118897931-118897953 AGGTAAAGACAGAAGGAAAATGG + Exonic
1089493597 11:118898002-118898024 ACGAGGAGACAGGAGCAGAAGGG + Exonic
1090213543 11:124940388-124940410 AAGTGGAGAGAGATGAAGACAGG + Intergenic
1090507316 11:127331415-127331437 AAGAGGAGGAAGAAGGAAAAAGG + Intergenic
1090680076 11:129046169-129046191 AATTGGAAAGAGAAGCAGAAGGG + Intronic
1090710186 11:129376627-129376649 CAGTGGAGACAGTAGGAGGCTGG - Intronic
1090845629 11:130527769-130527791 AAGGGGAGAGAGGAAGAGAAAGG - Intergenic
1090981165 11:131723863-131723885 AAGAGGAGAGAGAAAAAGAAAGG + Intronic
1091192442 11:133706889-133706911 AAGGGGGGACAGAAAGGGAACGG + Intergenic
1091192573 11:133707356-133707378 AAGGGGAAAGAGAAGGGGAAAGG + Intergenic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091691994 12:2603620-2603642 CAATGGAGACAGCAGGAGACAGG - Intronic
1091699521 12:2650779-2650801 AAGGGGAGAGGGAAGGTGAAGGG - Intronic
1092461146 12:8687417-8687439 AAGTGACCACAGAAGGAGGATGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092994766 12:13939437-13939459 ATGTGGCAACAGAAGGAGCAAGG - Intronic
1093097191 12:14984824-14984846 AAGTGGAGAGTGAATGTGAAGGG + Intergenic
1093473597 12:19531450-19531472 AAGGAGAGACAGAAGAACAAAGG - Intronic
1093551379 12:20415833-20415855 AATTGGAGACAGAAACAGAGAGG + Intronic
1093778980 12:23112062-23112084 AAAAGGAGAAACAAGGAGAAAGG - Intergenic
1093993273 12:25613959-25613981 GAGAGGAGACAGAAGGACAAAGG + Intronic
1094156086 12:27338221-27338243 AAGTGGATAAAGCAGGAGAAGGG + Intronic
1094387274 12:29908926-29908948 AATGAGAGACAGAAAGAGAAAGG - Intergenic
1094451449 12:30586819-30586841 CACTGGAAACAGAATGAGAATGG - Intergenic
1094715326 12:33008210-33008232 AAGAAGAGAAAGAAGGAGGAAGG - Intergenic
1095804122 12:46299691-46299713 AAGTAGGGCCAGGAGGAGAATGG + Intergenic
1096280857 12:50252200-50252222 AAGTGAAGGCAGGAGGAGGAAGG + Intronic
1096786543 12:54020050-54020072 AGGGAGAGAAAGAAGGAGAAGGG - Intronic
1096836671 12:54355649-54355671 AAGGGGAGATACAAGGAGAATGG - Intergenic
1096841626 12:54383408-54383430 GAGTGGAGAGAAAGGGAGAATGG - Intronic
1096875241 12:54624893-54624915 AAGGAAGGACAGAAGGAGAAGGG - Intergenic
1097224291 12:57467959-57467981 GAGTGGAGACAGAAGGCAAACGG - Intronic
1097959706 12:65520531-65520553 AAATGCAGAAAGAAGGAGAGAGG - Intergenic
1098085766 12:66841246-66841268 AAGAAAAGAGAGAAGGAGAAAGG - Intergenic
1098203225 12:68079325-68079347 AAGTGGAGAGAAAAGGAGGGTGG - Intergenic
1098523527 12:71460683-71460705 AAGTGGAGGCAGAATCAGACTGG + Intronic
1098564307 12:71914828-71914850 AAGTAAAGAAAAAAGGAGAAGGG - Intronic
1098630182 12:72713396-72713418 AAGTGTAGAGACAGGGAGAAGGG + Intergenic
1098816013 12:75163140-75163162 AAGGGGAGAGAGAGGGAGATTGG + Intronic
1099147429 12:79064225-79064247 AAGAAAAGACTGAAGGAGAAAGG + Intronic
1099163857 12:79277014-79277036 AAGAGGAAGAAGAAGGAGAAGGG + Intronic
1099323624 12:81182823-81182845 AAGTGGAAAGGGAAAGAGAATGG - Intronic
1099740160 12:86624646-86624668 CAGTGGAGGAAGAAGGGGAAGGG + Intronic
1099876219 12:88409301-88409323 GAGTATAGAAAGAAGGAGAATGG + Intergenic
1099915700 12:88890301-88890323 TAGTGTAGTCAGAATGAGAAAGG - Intergenic
1100103428 12:91138639-91138661 AATGGGAGACAGAGGGAGTAAGG + Intergenic
1100679535 12:96903715-96903737 AAGAGGAGAAAGGAGGAGAAGGG - Intergenic
1100782764 12:98046997-98047019 AAGGGGAGAGAGATGGAGAGAGG + Intergenic
1100848460 12:98684463-98684485 AGGAGGAGACAGAAGAAGAGAGG - Intronic
1101011276 12:100452556-100452578 AAGGGAAGAAAGATGGAGAATGG + Intergenic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101260255 12:103021983-103022005 AAGTGCAGAGTGAAGGAGGATGG - Intergenic
1101489500 12:105198095-105198117 AAGTGGAAAGAGCAGCAGAAGGG + Intronic
1101523551 12:105506907-105506929 AAATAGAGAAAGAGGGAGAAAGG + Intergenic
1102143648 12:110637646-110637668 AAGAGGAGAGAGAAGGAGACTGG - Intronic
1102162379 12:110780071-110780093 AAATAGAGACAGAAAGAAAAAGG + Intergenic
1102990704 12:117313809-117313831 TAGGGGAGCCAAAAGGAGAAAGG - Intronic
1103925703 12:124422461-124422483 AGGTGGAGACCGAAGGGGTATGG + Intronic
1104232505 12:126898716-126898738 AAGGGGAGAGAGAGGGAGAGAGG + Intergenic
1104477084 12:129079592-129079614 AGGTCGAGAAAGCAGGAGAATGG - Intronic
1105202301 13:18190947-18190969 AAATTGAGACAGATTGAGAAGGG - Intergenic
1105597427 13:21852105-21852127 AAGTACAGACACAAGAAGAAAGG + Intergenic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1105984359 13:25550645-25550667 AAGGAGAAACGGAAGGAGAATGG - Intronic
1106086666 13:26548799-26548821 AAGTAGAGACAGCTGGAGAAGGG - Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106362672 13:29046855-29046877 AAGTGGAGAGGAAAGGGGAAGGG - Intronic
1106549295 13:30757663-30757685 AAGTGGTGACAGATGAAGAGAGG - Intronic
1107183356 13:37487718-37487740 AAGTGGAAGATGAAGGAGAAAGG + Intergenic
1107295746 13:38905486-38905508 ATGTGGACACATAAGGAGTAAGG - Intergenic
1107419539 13:40233686-40233708 AAGCAGAGAGTGAAGGAGAAAGG + Intergenic
1107426060 13:40293953-40293975 AAGTAGAGACACATGCAGAATGG + Intergenic
1107459103 13:40584074-40584096 AGGGGGAGACAGATGGGGAATGG + Intronic
1107504411 13:41017595-41017617 AAGTGGAGTTTCAAGGAGAAGGG - Intronic
1107788789 13:43980116-43980138 TCATGGTGACAGAAGGAGAAAGG + Intergenic
1107877428 13:44803090-44803112 AAGTGCAGACAGGGTGAGAAAGG - Intergenic
1108060670 13:46529862-46529884 AAATGGAGAGAGCAGGAAAATGG + Intergenic
1108067197 13:46590289-46590311 AAGAGGAGATAGAAAGAGATAGG - Intronic
1108148094 13:47500976-47500998 AAGGGCAGACAGAATGAGAAGGG - Intergenic
1108281691 13:48868079-48868101 AAATGGCGACAGAATTAGAATGG + Intergenic
1108304059 13:49113210-49113232 AAGAGGGGAGAGAAGGAGAGAGG - Intronic
1108928915 13:55790020-55790042 AAATGGAGAAAGAAAGAGAAAGG - Intergenic
1108949788 13:56076792-56076814 AAATGGAGGCAGAAGGAGCTTGG + Intergenic
1109116478 13:58393994-58394016 AGTTGGAGACAGGAGGAGTATGG + Intergenic
1109448986 13:62483784-62483806 GAGTGGAGAAAGAGGAAGAAGGG - Intergenic
1109632858 13:65075686-65075708 AAGTGGAGAGTGGAGGAGAGTGG - Intergenic
1109707386 13:66114293-66114315 AATTGGAAACAGACAGAGAAAGG - Intergenic
1109809572 13:67494067-67494089 AAATGGAAAGATAAGGAGAAAGG + Intergenic
1110055627 13:70967093-70967115 AAGGGGAGAGAGAAAAAGAAAGG - Intergenic
1110366446 13:74691604-74691626 ATGTGGTGAGAGAAGGACAAGGG + Intergenic
1111186884 13:84749219-84749241 AAGTGGAGATATTAGGAGAATGG - Intergenic
1111331593 13:86765430-86765452 AGGTGGGGAGGGAAGGAGAAAGG + Intergenic
1111714482 13:91862967-91862989 AAGGGGAAAGAGAAGGAGAAAGG - Intronic
1111768129 13:92560524-92560546 AAGTAGTGAGAGAAGGAGATGGG + Intronic
1111999841 13:95199891-95199913 TAGTGGAGAGAGATGGGGAAGGG - Intronic
1112175548 13:97020007-97020029 ATATGGAGAAAGAAGGAGACTGG - Intergenic
1112184233 13:97112771-97112793 AAGTGGAGAAAGGAGGGGAGGGG - Intergenic
1112597723 13:100824054-100824076 AAGTGGTGATGGAAAGAGAATGG - Intergenic
1112633610 13:101189267-101189289 AAGGAGAGAAAGAAGAAGAATGG + Intronic
1112924546 13:104657552-104657574 AGGGAGAGACAGAGGGAGAAAGG - Intergenic
1113375194 13:109758936-109758958 AAGGGGAAAGGGAAGGAGAAGGG + Intronic
1113585249 13:111460185-111460207 GAGTGAAGAGAGAAGGGGAAAGG + Intergenic
1114136224 14:19854982-19855004 ATGTAGAGAAAAAAGGAGAAAGG - Intergenic
1114204639 14:20557390-20557412 AAGGAGAGAGGGAAGGAGAAAGG + Intronic
1114258092 14:21019283-21019305 AGGTGGAAACCAAAGGAGAAAGG + Intronic
1114517396 14:23308774-23308796 CAGGAGAGAAAGAAGGAGAAAGG - Intronic
1114524874 14:23361080-23361102 AGGTGGAGACAAACAGAGAATGG - Intronic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114762671 14:25333794-25333816 AAGAGGAGAAAGAATGACAAGGG + Intergenic
1115678800 14:35712939-35712961 AAGTAGAGAGCAAAGGAGAAAGG + Intronic
1116444358 14:44991327-44991349 CAGTGCTGACAGAAGGAGACTGG - Intronic
1116752881 14:48909095-48909117 AGGGGAAGAAAGAAGGAGAAAGG - Intergenic
1117169852 14:53082994-53083016 AAATGGGGACACAAGGACAAAGG + Intronic
1117286546 14:54291258-54291280 GAGTGGAGGAAGAAAGAGAAGGG + Intergenic
1117828632 14:59728395-59728417 AAGTGAAGAGAGGAGAAGAAAGG - Intronic
1117874817 14:60241102-60241124 ACGTGGAGAGAGCAGGAGAATGG + Intergenic
1117911987 14:60645832-60645854 AAATGGAAAGAGAAAGAGAAAGG - Exonic
1118294575 14:64557408-64557430 AAGGGGAAAGAGAAGGAGAAGGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118617187 14:67582092-67582114 AAGGGGAGACGGACCGAGAACGG + Exonic
1118669697 14:68110408-68110430 ATCTTGAGACAGATGGAGAAAGG - Intronic
1118793857 14:69121696-69121718 ATGTGGGGTCAGAAGGAGTATGG + Intronic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1119446215 14:74665632-74665654 AAGTAGAGGCAGAAGCTGAAGGG - Intronic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1119494521 14:75067464-75067486 AAGTGGAGAAAGTAGAAGACAGG + Intronic
1119866611 14:77980081-77980103 AAGTGGGGGCTGGAGGAGAAAGG - Intergenic
1119937701 14:78608019-78608041 AAATGGAGACAGGAGGGAAATGG + Intronic
1120373882 14:83675463-83675485 AAGTGAAGTCATAAAGAGAAGGG - Intergenic
1120404360 14:84076053-84076075 AAGAGGAGGCAAAAGGAGCAGGG - Intergenic
1120686496 14:87543858-87543880 AAGTAGATAAAGAAGAAGAAAGG + Intergenic
1121018979 14:90567401-90567423 TAGTGGAGAGCGAAAGAGAAAGG + Intronic
1121843229 14:97151816-97151838 AATTGGGGCCTGAAGGAGAAAGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122302108 14:100737092-100737114 TGGTGGAGACAGGAGGGGAAGGG - Exonic
1122392789 14:101401803-101401825 AAGAGGAAAGAGAAGGAGAAGGG - Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1122939334 14:104974234-104974256 AACTGGACACACAAGGAGGACGG - Intronic
1123072144 14:105647117-105647139 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123092153 14:105746635-105746657 AGGTGGGGGCAGAAGGAGCAGGG - Intergenic
1123679220 15:22745744-22745766 AAGTCAAGAAAGAATGAGAAAGG + Intergenic
1123736377 15:23188189-23188211 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124287083 15:28411166-28411188 AAGGGGAAAGCGAAGGAGAAAGG - Intergenic
1124295618 15:28500463-28500485 AAGGGGAAAGCGAAGGAGAAAGG + Intergenic
1124331440 15:28820194-28820216 AAGTCAAGAAAGAATGAGAAAGG + Intergenic
1124805729 15:32880519-32880541 CAGTGGAGAAGGAAGGTGAATGG - Intronic
1124887677 15:33702101-33702123 AAGTGGAGGCATAAAGAGATTGG + Intronic
1125730005 15:41887798-41887820 AAGTGGACACAGATGTAGAAAGG - Intronic
1125817154 15:42595734-42595756 AGATGGAGACAGAAGTCGAAGGG + Intronic
1126386567 15:48099579-48099601 ATGGGTAGGCAGAAGGAGAAGGG - Intergenic
1126532082 15:49721608-49721630 ACGTGGAGATAGAAACAGAAAGG + Intergenic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1127267570 15:57374255-57374277 AAGGAGAGAGAGAAGGGGAAGGG - Intergenic
1127568276 15:60214914-60214936 AAAAGGAGAGAGAAGGAGGAAGG + Intergenic
1128341256 15:66824011-66824033 ATGAAGAGAGAGAAGGAGAATGG + Intergenic
1128396198 15:67228979-67229001 GAGGGGAGACAGTAGGAGGAGGG + Intronic
1128453924 15:67822428-67822450 AAGTAGAGACAGATTGAGAGAGG + Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1128705752 15:69836549-69836571 CAGTGGAAACAGAAACAGAAAGG - Intergenic
1128867417 15:71125107-71125129 AAGGGGAAAGGGAAGGAGAAAGG + Intronic
1128877210 15:71212150-71212172 GAGTAGAAACAGAAAGAGAAAGG - Intronic
1129905268 15:79182807-79182829 AAGGGAAGAAAGAAAGAGAAAGG - Intergenic
1129968520 15:79757745-79757767 AAGTGGAGACAGAAGCATCGGGG + Intergenic
1129976982 15:79830874-79830896 AAGAAGAGACAGAAGGATAAAGG + Intergenic
1130112529 15:80977501-80977523 AAGTGGAAACAGAAGGTACAGGG + Exonic
1130873552 15:87992306-87992328 AAGTGAGGACAGAAGCTGAAAGG - Intronic
1130941302 15:88511561-88511583 CAGTGGAGACAGATGAAGGAAGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131079471 15:89522785-89522807 AACTGAAGCCAGAAGGAAAAAGG + Intergenic
1131244086 15:90774866-90774888 AAGTGGAGAAACATAGAGAAGGG + Intronic
1131489127 15:92847192-92847214 TAGTAGAGAGAGAAAGAGAATGG - Intergenic
1131604150 15:93882854-93882876 AAGAGGACACAGAAGGTAAAAGG + Intergenic
1131761202 15:95624410-95624432 CAGTTGAGACAGAAGAAGTAAGG + Intergenic
1131839408 15:96419669-96419691 AACAGGAGACAGTAAGAGAAAGG - Intergenic
1132013520 15:98296479-98296501 AAAGAGAGACAGCAGGAGAAAGG - Intergenic
1132182517 15:99769479-99769501 AAGTAGTGAGAGAAGGAGATGGG - Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1132997912 16:2832896-2832918 AAGTGGAGACAAAGGGAGGAGGG + Intronic
1133069632 16:3236185-3236207 AAACCGAGACAGTAGGAGAAGGG - Intronic
1133485421 16:6214732-6214754 AAGGAGAGGGAGAAGGAGAAGGG + Intronic
1133620602 16:7522490-7522512 TAGTGGAGAGAGATGCAGAAGGG + Intronic
1133678629 16:8099453-8099475 GTGTGGAGCCAGAAGCAGAAAGG + Intergenic
1133690981 16:8214798-8214820 AAGGAGAGACAAAAGGAGTAAGG + Intergenic
1133736232 16:8617866-8617888 ATGTGGAGTCAGGCGGAGAATGG - Intergenic
1133885355 16:9822423-9822445 AACTGGAGAGAGAACGAGAAAGG + Exonic
1133982015 16:10640028-10640050 AGGAAGAGAAAGAAGGAGAAGGG - Intronic
1134507561 16:14820708-14820730 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134563327 16:15229498-15229520 TGGTGGAGAGAGAAGAAGAAGGG + Intergenic
1134682381 16:16135311-16135333 AAGTGGGGACAGATGGAGGAGGG - Intronic
1134695259 16:16219470-16219492 ATGTGGAAACAGGAGGAGAAAGG + Intronic
1134718963 16:16370596-16370618 AAGGGGAGAGAGATGGAGAAAGG - Intergenic
1134782105 16:16907457-16907479 AAAGAGAGACAGAAGGAGAGAGG - Intergenic
1134923854 16:18141126-18141148 TGGTGGAGAGAGAAGAAGAAGGG + Intergenic
1134976573 16:18575216-18575238 ATGTGGAAACAGGAGGAGAAAGG - Intergenic
1135107259 16:19661033-19661055 AAATGGAGAGTGAAGGAGAAAGG - Intronic
1135186057 16:20316902-20316924 AAGGGAAGAGAGAGGGAGAAAGG - Intronic
1135206277 16:20486961-20486983 AAGTAGGGAAAGAAGGAGAGAGG + Exonic
1135795975 16:25442876-25442898 AAGGAGAAAGAGAAGGAGAAGGG - Intergenic
1136349870 16:29699773-29699795 AAGTGTAGCCAGATGGACAAGGG - Intergenic
1136360282 16:29775013-29775035 AAGAAGAGGCAGAAGGAAAAAGG + Intergenic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1137636637 16:49992671-49992693 AAGTGGAGGCAGGTGGATAACGG + Intergenic
1138035143 16:53596740-53596762 AGGTGCCCACAGAAGGAGAAGGG - Intergenic
1138150895 16:54655793-54655815 AAGTGGAGAAGGAAGGAGAGGGG + Intergenic
1138197544 16:55062701-55062723 ATGTGGAGATGGAAGGGGAAAGG + Intergenic
1138505343 16:57475715-57475737 AGGAGGAGAGAGAAGGAGGAGGG - Intronic
1138600533 16:58051510-58051532 AAGAAGGGAAAGAAGGAGAAAGG + Intergenic
1138766954 16:59616656-59616678 AAGTAGAGAAAAAAGGAAAAAGG + Intergenic
1139018128 16:62714847-62714869 AAGGAGAAAAAGAAGGAGAAGGG - Intergenic
1139299876 16:65935781-65935803 GATTAGAGACAGAGGGAGAAGGG - Intergenic
1139358784 16:66383631-66383653 CAGTGGAGACTCAAAGAGAAGGG - Intronic
1139814894 16:69661192-69661214 AATGGGAGACAGAAGGAAACAGG - Intronic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140914668 16:79483088-79483110 AAGTAGGGACAGAGGGAGGAAGG - Intergenic
1141128806 16:81420482-81420504 ACGTGAAGACAGAGGGTGAAGGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141758305 16:86009839-86009861 AAGTGGATAGTCAAGGAGAAGGG + Intergenic
1141812337 16:86383785-86383807 AAGGAGGGACAGAGGGAGAAAGG + Intergenic
1141921483 16:87138560-87138582 CAGAGGAGACAGAAGGGCAAAGG + Intronic
1142176822 16:88649238-88649260 ATGTGGAGACAAAAACAGAATGG - Intronic
1203142496 16_KI270728v1_random:1777482-1777504 AAGAGGAGGCAGAAAGAGAAGGG - Intergenic
1143182546 17:4992673-4992695 AAGGAGAGAAAGAAAGAGAATGG - Intronic
1143478906 17:7217612-7217634 AAGGGGAGAGAGGAGGAGAGAGG + Intronic
1143701140 17:8661045-8661067 AAGGAGAGAGAGAAAGAGAAGGG - Intergenic
1144042605 17:11426192-11426214 AAATAGTGACAGAAGGTGAAAGG + Intronic
1144092180 17:11868041-11868063 AAGTGGAGACCGCTGGAGCAGGG - Intronic
1144546357 17:16199633-16199655 AAGTTCAGACTGAAGGGGAAGGG + Intronic
1144554307 17:16268341-16268363 AAGTGGCAACAGAAGGGAAATGG - Intronic
1145110625 17:20158234-20158256 AGGGGGAAGCAGAAGGAGAAGGG + Intronic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145300023 17:21627671-21627693 AAGTTCAGACTGAAGGGGAAGGG - Intergenic
1145350265 17:22075605-22075627 AAGTTCAGACTGAAGGGGAAGGG + Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1145990382 17:29075761-29075783 CAGTGGAGGCAGGAGGAGTACGG - Exonic
1145992133 17:29085647-29085669 AACTGGAAATAGAAGGAAAATGG + Exonic
1146158069 17:30541040-30541062 AATAGGAGACAAAAGGAAAATGG - Intergenic
1146542368 17:33708518-33708540 AAGAGAAGAAAGAAGGAGACAGG - Intronic
1146710496 17:35036899-35036921 AAGGGGAGAGAGGAGTAGAAGGG + Intronic
1146846535 17:36184617-36184639 ATGTGGAGAAAGAAGCAGAATGG - Intronic
1147442363 17:40454926-40454948 AAGTCTAGATAGAAGGACAAAGG + Intronic
1147447741 17:40485006-40485028 ACCTGGAGACAGACAGAGAAGGG + Exonic
1147492187 17:40879987-40880009 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1147569465 17:41559625-41559647 GAGTGGAGAGAGAAGTAGAGGGG - Intergenic
1148581435 17:48746858-48746880 AAATGGAGAAAGAAGGAAAGCGG + Intergenic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1148737042 17:49870813-49870835 AAGGGGAGAGGGAAGGAAAAAGG - Intergenic
1148778956 17:50111041-50111063 AAGAGGAGACTGAATGAGACTGG + Exonic
1148889328 17:50796484-50796506 AGGTAGAGACAGAGAGAGAAAGG + Intergenic
1149148999 17:53536456-53536478 ATGTGGTGAAAGAAGGAGCAAGG - Intergenic
1149479959 17:56995400-56995422 AAGAGGGGAAGGAAGGAGAACGG - Intronic
1149560540 17:57605061-57605083 AAATGGCAACAGAAGCAGAATGG - Intronic
1149576692 17:57718726-57718748 CAGGAGAGAAAGAAGGAGAAAGG + Intergenic
1149654353 17:58302452-58302474 AATGTGAGACAGAAGGAGCAAGG + Intronic
1150118050 17:62572254-62572276 CAGTAGAGGAAGAAGGAGAAGGG + Intronic
1150181373 17:63124520-63124542 AAGAGGAGAAAGAAAGAGAGAGG + Intronic
1151193737 17:72416919-72416941 AAGTGGACCTAGAAGGAGAAAGG - Intergenic
1151249416 17:72822021-72822043 AGCTGGAGACAGGAAGAGAATGG + Intronic
1151409021 17:73908717-73908739 AAGTCGTGACAGTAAGAGAATGG + Intergenic
1151429832 17:74055007-74055029 AAAGGGAGAGAGAGGGAGAAAGG - Intergenic
1151596765 17:75082697-75082719 AAATGGACACAGAAGGAGACAGG - Intergenic
1152032365 17:77851824-77851846 AGGTGGAGACAGAAGAAGAGGGG - Intergenic
1152207178 17:78980536-78980558 AGGGGGAGACAGTAGGAGAGTGG - Intergenic
1152332615 17:79681839-79681861 AGAGGGAGAGAGAAGGAGAAAGG + Intergenic
1153376366 18:4384931-4384953 GAGTGGAGAGAAAAGGAGCAGGG - Intronic
1153530733 18:6042954-6042976 ATTTGGAGATAGCAGGAGAAGGG - Intronic
1153671899 18:7419576-7419598 AAGGAGGGACAAAAGGAGAAAGG + Intergenic
1153711007 18:7798712-7798734 ATAAGGAGAGAGAAGGAGAAAGG - Intronic
1153761306 18:8334879-8334901 AAGTGGGAACAGGAGGAGCAAGG - Intronic
1153764838 18:8365629-8365651 AAGAGGAGAGAGAGGGAGAGAGG - Intronic
1155227272 18:23739568-23739590 AAGATGTAACAGAAGGAGAAGGG + Intronic
1155268336 18:24115592-24115614 AAGTGGAGACAGAATGCTCAGGG + Intronic
1155276609 18:24194096-24194118 AACAGGAGAGAGCAGGAGAAAGG + Intronic
1155377558 18:25176974-25176996 AGATGTAGGCAGAAGGAGAAGGG - Intronic
1155410630 18:25541080-25541102 AGTTGGAGACAGAAACAGAAGGG + Intergenic
1155545413 18:26909719-26909741 AGGTGGAGAAAACAGGAGAAGGG - Exonic
1156159121 18:34338566-34338588 AAGAGGAGACAGAAACAGAAGGG + Intergenic
1156503739 18:37576060-37576082 AAGTGGACACACAAGGTAAAGGG - Intergenic
1156611957 18:38735345-38735367 AAATGAAGAGAGAAAGAGAAAGG - Intergenic
1156740346 18:40319083-40319105 AAGTGTAGACACAATGACAAAGG - Intergenic
1157146680 18:45170292-45170314 CATTAGAGACAGAAGCAGAAGGG + Intergenic
1157385547 18:47257092-47257114 GAGAGGAGAAAAAAGGAGAAGGG + Intergenic
1157475262 18:48019996-48020018 AAGTGTAGAGAGTTGGAGAAGGG + Intergenic
1157516283 18:48313964-48313986 AGCTGGAGCAAGAAGGAGAAGGG - Intronic
1157630722 18:49092757-49092779 ATCTGGGGACAGAAGGAGAAGGG + Intronic
1157665891 18:49486786-49486808 TAGTGGAGACAGAGGGAGCGGGG + Intronic
1158203241 18:54962784-54962806 TAGTGGAGTGAGTAGGAGAACGG - Intergenic
1158468721 18:57714556-57714578 AGGGAGAGAGAGAAGGAGAAAGG + Intronic
1158894700 18:61901773-61901795 TTGTGGAGATAGAAGGAAAAGGG - Intergenic
1159075781 18:63680264-63680286 AAGAGGAGACTGAAGGTGAAAGG + Intronic
1160589336 18:79934034-79934056 AAAGGGAGACAGAAACAGAAAGG + Intronic
1160905358 19:1449505-1449527 AGGGGGAGACAGAAAGAGAGAGG + Intronic
1161009776 19:1954619-1954641 CAGTGGAGACAGTCAGAGAAGGG + Intronic
1161368560 19:3895644-3895666 AAGTGAGGAAAGCAGGAGAAAGG - Intronic
1161404052 19:4081965-4081987 AAGAGGAGAGAGGAGGAGCAGGG - Intergenic
1161485525 19:4533723-4533745 ACGTGGAGACAGAAGGATACAGG + Intronic
1161845631 19:6710526-6710548 AAGGAGAGAGAAAAGGAGAAAGG + Intronic
1161851842 19:6741200-6741222 AAGGGGAGACAGAGGTAGGAGGG - Intronic
1161970658 19:7578044-7578066 AAGAGGACACCGAAGGAGGAAGG + Intergenic
1162248038 19:9419250-9419272 AAGAAAAGACAGAAGTAGAAAGG - Exonic
1162424775 19:10588005-10588027 CAGAGGAGAAAGAAGGTGAATGG - Intergenic
1162691520 19:12437500-12437522 AAAAGGAGACAGAAAAAGAAAGG + Intronic
1162777252 19:12987372-12987394 GAGGGGAGAGGGAAGGAGAAGGG + Intergenic
1162790287 19:13059312-13059334 AAAAGGAGAGAGAAGGGGAAGGG - Intronic
1162963864 19:14146324-14146346 AAACGGAGAAAGAAAGAGAAAGG - Intergenic
1163003786 19:14384719-14384741 AAGGGGAAACAGGAGGAGATGGG - Intronic
1163050208 19:14677495-14677517 TAGAGGAGACAGGACGAGAATGG + Intronic
1163071770 19:14848588-14848610 AAGACAAGACAGTAGGAGAAAGG + Intergenic
1163172090 19:15538614-15538636 AAGTGGGGACATAAGGAATAAGG + Intronic
1163207420 19:15813828-15813850 AAGTGGAGAGAGAGGGAGGTGGG + Intergenic
1163504496 19:17697411-17697433 AAGAGAAGACAGAAGCAGCATGG - Intergenic
1163812652 19:19443583-19443605 AGTGGGAGAGAGAAGGAGAAAGG + Intronic
1164425998 19:28142463-28142485 AAGGGGAGAGGGAGGGAGAACGG + Intergenic
1164859421 19:31551163-31551185 AAGAGGGGAGAGAAGGAGAAGGG - Intergenic
1165080785 19:33304781-33304803 AGGAGGAGACAGAAGGAGTAGGG + Intergenic
1165639767 19:37374326-37374348 AGGTGGAGAGAGAAGTGGAAGGG - Intronic
1166184655 19:41132087-41132109 AAGAGAAGAGAGAAGAAGAAAGG + Intergenic
1166516701 19:43452481-43452503 AGGTAGAGACGGAAGGACAATGG + Intergenic
1166569719 19:43786024-43786046 AAATGAAGAAAAAAGGAGAAAGG - Intergenic
1166655405 19:44607630-44607652 AAGTGGAGAGGAAAGGGGAAGGG - Intergenic
1166763325 19:45238171-45238193 AATTGGGGATAGAAAGAGAAGGG + Intronic
1167091997 19:47350770-47350792 AACTGAAGAGAGATGGAGAAAGG + Intronic
1167212226 19:48140238-48140260 AAATGGAGAAAGAAGAGGAAAGG + Intronic
1167759824 19:51439045-51439067 AAGTGGATAGAGAAGGTGAGAGG - Intergenic
1168006707 19:53495832-53495854 GAGAGGAGACAGGAAGAGAAGGG - Exonic
1168251571 19:55145308-55145330 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168348523 19:55662437-55662459 AGGTGGAGAGAGGAGGGGAAGGG - Intronic
1168485129 19:56755006-56755028 AAGGGGAAAATGAAGGAGAAAGG + Intergenic
925496539 2:4456417-4456439 ATATGCAGACAGAAAGAGAAAGG + Intergenic
925500555 2:4499512-4499534 AAGTGGAGGAGGCAGGAGAAAGG + Intergenic
925542321 2:4979271-4979293 AAGAGGAGACCGAAGTGGAAAGG + Intergenic
925817628 2:7768905-7768927 ACGTGGCTAGAGAAGGAGAAAGG - Intergenic
926083226 2:10005468-10005490 AAGTGGTGAAAGAAGAAGATGGG + Intergenic
926254891 2:11184268-11184290 AAAAGGAGAGAGATGGAGAAAGG + Intronic
926553218 2:14325615-14325637 AAGGGAGGAAAGAAGGAGAAGGG + Intergenic
926603799 2:14876369-14876391 GAGTGGAGACATAAGGAAACTGG - Intergenic
926962902 2:18378311-18378333 ATGAGGAGTCAGGAGGAGAATGG + Intergenic
927809921 2:26175186-26175208 AAGTTGTGCCTGAAGGAGAAAGG + Intronic
927830645 2:26346731-26346753 AAGTGGAGACATCAGCAGGATGG - Intronic
928042912 2:27896422-27896444 AAGTGGAGAGAGATGGGAAATGG - Intronic
928135491 2:28684678-28684700 AACTGGAGTCAGATGGTGAAGGG - Intergenic
928427147 2:31188764-31188786 AACTGGATACAGTAGTAGAATGG + Intronic
928443497 2:31312799-31312821 TAGTGGAGAGAGAAGGAAAGAGG - Intergenic
928691247 2:33801433-33801455 CAGGGGAGACAGTAGGAGAGAGG + Intergenic
928694124 2:33831809-33831831 AAGGGAAGACAAAAGGAGCAGGG + Intergenic
928794728 2:35004323-35004345 AAGGGGAGAAATAATGAGAAAGG - Intergenic
928813106 2:35253641-35253663 AAGGGGAGCTGGAAGGAGAATGG - Intergenic
928959726 2:36911658-36911680 AAGTGAAGACACAAGGAGGCTGG - Intronic
929052402 2:37849211-37849233 AAGTGGGGGAAGAAGGAGAAGGG - Intergenic
929362151 2:41104531-41104553 AAGGGAAGGAAGAAGGAGAAGGG + Intergenic
929719240 2:44350658-44350680 AATTGGAGGCAGAAGATGAAAGG - Intronic
929936778 2:46298896-46298918 GGGTGGAGACAGGAGGAGAAAGG - Intronic
930014038 2:46958467-46958489 AAGAGGAGAGAGCAGGAGACAGG - Intronic
930197946 2:48528289-48528311 AAGTGGAGCAAGAAGGACACAGG - Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930428236 2:51239057-51239079 AAGTAGAGAGGGAAGGAGGAAGG - Intergenic
930443966 2:51446895-51446917 AAGAGTAGAAAGAATGAGAAAGG - Intergenic
930798928 2:55421959-55421981 AAATACAGACAGAAGGAGAGTGG + Intergenic
931196198 2:60054225-60054247 CACTGCAGAGAGAAGGAGAAAGG - Intergenic
931644736 2:64411644-64411666 AAGTGGAGACAAAATGTGTAAGG - Intergenic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
931999577 2:67872276-67872298 AACTGTTGACAGATGGAGAATGG + Intergenic
932084551 2:68746651-68746673 AAATGGAGATGGAGGGAGAAGGG + Intronic
932138448 2:69253403-69253425 GAGTGGAGAGAGAAATAGAAGGG + Intergenic
932169976 2:69545734-69545756 AAGTTCAGACAAAAGTAGAAAGG + Intronic
932220717 2:69997023-69997045 AAGTGGACACACAAGGAGGCTGG + Intergenic
932387987 2:71356081-71356103 AGGTGGAGATAGGAGAAGAAAGG - Intronic
932467110 2:71931012-71931034 AAGAGAAGGCAGGAGGAGAAAGG + Intergenic
932488745 2:72104933-72104955 AGGAGGAGACATAAGGAGACAGG + Intergenic
932739859 2:74283123-74283145 AGTTAGAGACAGAAAGAGAAAGG + Intronic
932907077 2:75765725-75765747 AAGTGGAGACAGAAAAGGAGGGG + Intergenic
933088793 2:78092998-78093020 AAATGAAGAAAGAAGGAGACTGG - Intergenic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933195859 2:79388763-79388785 AAGAGGAGAGAGAAAGAAAAAGG - Intronic
933343878 2:81058380-81058402 AAGTGGAAACAAAAAGAGCAGGG - Intergenic
933783860 2:85822563-85822585 ATGTGGAGAGAGAGGGAGGAAGG - Intergenic
933947466 2:87299002-87299024 AAGGAGAGACAGAAGGGGCATGG - Intergenic
934164477 2:89281730-89281752 AAATGACGACAGCAGGAGAATGG + Intergenic
934202797 2:89900794-89900816 AAATGACGACAGCAGGAGAATGG - Intergenic
934552812 2:95272514-95272536 AATTGGAGGGAGAAGGAGAAGGG + Intergenic
935224940 2:101045336-101045358 ATGGGGAGACAGAGAGAGAAAGG - Intronic
935558646 2:104538198-104538220 AAGTGGGGAGGGAAGAAGAAGGG + Intergenic
935782262 2:106518721-106518743 AAGTAGAGAGAAAAGGAGACAGG - Intergenic
935879297 2:107544958-107544980 GAGTGGAGATGGAAGGAGACTGG + Intergenic
935924997 2:108058355-108058377 AATTGGAAACACAAGGAAAAAGG + Intergenic
936263604 2:110982430-110982452 AAGGGATGACAGAAGAAGAAGGG - Intronic
936332729 2:111562565-111562587 AAGGAGAGACAGAAGGGGCATGG + Intergenic
936460403 2:112710124-112710146 AATTGGGGACAGTTGGAGAAGGG + Intergenic
936734931 2:115428847-115428869 AACTGGACACAGAAGTAGAGTGG - Intronic
936781732 2:116040928-116040950 AAGTGGATTCAGAGGAAGAAGGG + Intergenic
937139668 2:119588998-119589020 AAGAGGAGAATGAAGGAGAGAGG + Intronic
937211548 2:120275851-120275873 AATAGGAGAAAGAAAGAGAACGG + Intronic
937651664 2:124326131-124326153 AAGTGGAGACAGAGGAGGGAAGG + Intronic
938100127 2:128492881-128492903 AGGAGGAGAGAGGAGGAGAAGGG - Intergenic
938580117 2:132638120-132638142 AAAAAGAGACAGAGGGAGAAAGG + Intronic
938745250 2:134271863-134271885 AAGTGGAGACTGAAGAGGCATGG - Intronic
939035001 2:137120418-137120440 AAGTGGAGGAAGAAAAAGAAGGG + Intronic
939339581 2:140877060-140877082 AAATGGAGAAAAAAGGAAAAAGG - Intronic
940393214 2:153157055-153157077 AAGTGGAGACATAAGGCATATGG + Intergenic
941060545 2:160842401-160842423 AAGTGTAGGCAGATGGAGAGGGG + Intergenic
941207342 2:162590384-162590406 AATTGGAGACAAAAACAGAAAGG + Intronic
941338602 2:164276735-164276757 AAGAGGGGAGGGAAGGAGAAAGG + Intergenic
942101950 2:172592323-172592345 AAGAGGAGTCAGAAAGAGAGAGG - Intronic
942415384 2:175753201-175753223 AAGAGGAGAAAGAAGAAGAAGGG - Intergenic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
942720603 2:178948472-178948494 AAGTGGAGTCAGGAGAAGAGCGG + Intronic
943411274 2:187551530-187551552 AAGTGAAGACAGGGAGAGAAAGG + Intronic
943516917 2:188899999-188900021 AAGAGGAGCCAGAGGGAGATCGG - Intergenic
943617356 2:190108692-190108714 TATTGGAATCAGAAGGAGAATGG + Intronic
943642719 2:190376574-190376596 AAGTGGGGACAGAAGGAATTAGG + Intergenic
943731375 2:191306670-191306692 AGGTGAAGAGAGAGGGAGAAAGG + Intronic
944425028 2:199572176-199572198 AAATGGAGGCAGCAGCAGAAAGG - Intergenic
944669652 2:201984341-201984363 AGGTGGAGACAGAAAGAGCAGGG + Intergenic
944743253 2:202632940-202632962 AGGGGGAGAGAGGAGGAGAAAGG + Intergenic
945609303 2:211978334-211978356 AGGTGGAGCCAGAAAGTGAAAGG + Intronic
946098152 2:217293248-217293270 ATGAGGAGACTGAAGCAGAAAGG - Intronic
946202210 2:218076891-218076913 AAAGGGAGACAGAAAGAGATGGG - Intronic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946388887 2:219403824-219403846 AAATGGAGGCACAAGGAGGAAGG + Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946482887 2:220073811-220073833 AAGGGGAGGCAGAAGGAAAATGG + Intergenic
946541678 2:220690892-220690914 TAGTTGAGACTGAAGGAGAGTGG - Intergenic
946565167 2:220956529-220956551 AAGTGGTGAAAGAGGGATAAAGG - Intergenic
946842525 2:223832685-223832707 AAATTGATACAGAAGGGGAAGGG + Intronic
947008276 2:225537168-225537190 AAATGAAGACAGAGAGAGAAGGG - Intronic
947077041 2:226355916-226355938 GAGAGGAGAGAGAAAGAGAAAGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947278093 2:228417343-228417365 AGAAGGAGAGAGAAGGAGAAAGG + Intergenic
947317196 2:228873559-228873581 AGGAAGTGACAGAAGGAGAATGG + Intronic
947476246 2:230450065-230450087 AAGTAGAAACAGGAGAAGAAAGG + Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947572796 2:231249163-231249185 AAGTAGAGACAGCAGCAGGATGG - Intronic
947907856 2:233778581-233778603 AACTTGGGACAGGAGGAGAAAGG + Intronic
947940811 2:234053681-234053703 AATTTGAGAAAGGAGGAGAAAGG + Intronic
948435584 2:237951487-237951509 AAGAGAAGAAAGAAAGAGAAAGG + Intergenic
948589209 2:239038684-239038706 AAGAGGAGACACACGGAGAAGGG - Intergenic
948625701 2:239266669-239266691 ATGTGGAGACAGAGGGAGAGAGG - Intronic
948698553 2:239746631-239746653 AAGTGGAGAGAACCGGAGAATGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168754508 20:306750-306772 AAGAGGAGAAAGAAAGAGAGAGG - Intergenic
1169357764 20:4922360-4922382 AAGCGGAGACAGCAGGATGAAGG + Intronic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1169550672 20:6698232-6698254 AGGTGGAGACAGAAGAGGCAGGG - Intergenic
1169953207 20:11071402-11071424 AAGAGGTGTCAGAAGGAGTAAGG - Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170039570 20:12025735-12025757 AGGTAGAGACAGAAAGAGAAAGG - Intergenic
1170295741 20:14823429-14823451 AAGTGCAGACATAAGGAGTCTGG + Intronic
1170327367 20:15171378-15171400 AAAGAGAGACACAAGGAGAAAGG - Intronic
1170330347 20:15202811-15202833 CAGTGTAGACAGAAAGAAAAAGG + Intronic
1170919853 20:20667748-20667770 AAGGGGAAACAGATGGAGAAAGG + Intronic
1170942289 20:20858459-20858481 AAGTGGAGCCAGAAGATGACAGG - Intergenic
1171306039 20:24107180-24107202 AAGTGGAGACAGAAGCCACAGGG - Intergenic
1171560524 20:26120593-26120615 AAGTTCAGACTGAAGGGGAAGGG + Intergenic
1171847899 20:30288847-30288869 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1172022967 20:31927544-31927566 TAGTGGATACAGAGGTAGAAAGG + Intronic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1172206202 20:33164527-33164549 ATGTGGAGAGAGAAGAAGAAAGG - Intronic
1172221285 20:33276749-33276771 AAGGAGAGACAGAAAGAGAAGGG + Intronic
1172263888 20:33593842-33593864 ATGTGTGGACAGAAGGGGAAAGG - Intronic
1172442865 20:34978099-34978121 AAGTGGAGACAGAGGGGGAGGGG + Intronic
1172476549 20:35242645-35242667 AAGTTGAGTGAGAAGGTGAAGGG + Intronic
1172479027 20:35260203-35260225 AGGGGGAGACAGAGGGAGCAGGG - Intronic
1172723747 20:37019686-37019708 AATTGTAGACAGAAAGAGAGAGG - Intronic
1173053441 20:39588212-39588234 AGGTGAAGACAGAGAGAGAACGG - Intergenic
1173127835 20:40356358-40356380 ACTTGGGGACAGGAGGAGAAGGG + Intergenic
1173313060 20:41917655-41917677 AAGGAGAGGCAGAGGGAGAAGGG + Intergenic
1173355776 20:42288507-42288529 AAGTGGGGAAAGAGGGAGAGAGG - Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173602571 20:44306592-44306614 GAGGGGGGACAGAAGGACAATGG - Exonic
1173751816 20:45482348-45482370 GAGTGGGGAGAGAAGTAGAAGGG - Intergenic
1173939995 20:46902581-46902603 CAGGGCAGACAGATGGAGAAAGG - Intronic
1175531056 20:59674520-59674542 AAGGGGAGACAGAAGAAGCGGGG - Intronic
1175587778 20:60159020-60159042 AAGGGGAGAAAGAACGGGAAAGG + Intergenic
1176650633 21:9543813-9543835 AAGTTCAGACTGAAGGGGAAGGG - Intergenic
1176715649 21:10347061-10347083 AAATTGAGACAGATTGAGAAAGG + Intergenic
1176742565 21:10617396-10617418 AAGAGGAGAAGGAAGGAAAAAGG + Intergenic
1176813611 21:13572840-13572862 ATGTAGAGAAAAAAGGAGAAAGG + Intergenic
1177294452 21:19156609-19156631 AAGGAGAGACAGAGAGAGAATGG + Intergenic
1178816423 21:35934137-35934159 GAGTGGAGAGAGTGGGAGAAAGG + Intronic
1179169323 21:38960795-38960817 AAATGGAGCGAGAAGGGGAAAGG - Intergenic
1179296809 21:40070211-40070233 AAAAGGAGAGAGAAGGGGAAAGG + Intronic
1179376771 21:40856445-40856467 AGGTGGAGAGAGGAGGAGAAAGG + Intergenic
1179470945 21:41609964-41609986 GAGTGGAGAGAGAAGAGGAATGG - Intergenic
1179488580 21:41726452-41726474 AGGAGGAGAAAGAAGGAGAGAGG - Intergenic
1180602695 22:17032892-17032914 AAATTGAGACAGATTGAGAAGGG - Intergenic
1180955163 22:19738221-19738243 AAGGGGAGACTGGAGGAGGAGGG - Intergenic
1181690719 22:24558115-24558137 AAGTGGAGGCAAATGGATAATGG - Intronic
1182024463 22:27107121-27107143 AAGTGGACCCAAAAAGAGAAGGG + Intergenic
1182126057 22:27816697-27816719 AAGAGGAGAAAGAAAAAGAAAGG - Intergenic
1182250958 22:28999865-28999887 ATGTAGAGACAGAAGGAAAGGGG + Intronic
1182404665 22:30115788-30115810 AAGTGGAGAATGAAGAAGGAGGG + Intronic
1182550878 22:31100179-31100201 AAAGGGAGAGAGAGGGAGAAGGG - Intronic
1182550927 22:31100398-31100420 AAGGGAAGACAGATGGAGAAGGG - Intronic
1182738296 22:32546868-32546890 AAGGAGAGAGAGAAGGAGAGAGG - Intronic
1182886407 22:33777666-33777688 AAGGGGAAGGAGAAGGAGAAGGG + Intronic
1183133018 22:35857722-35857744 AAGTAGAGACAAAAGAAAAATGG + Intronic
1183844302 22:40528165-40528187 AAGTGGAGTCAGAATGCGACAGG - Intronic
1183977954 22:41524002-41524024 AGGAGGAGGCAGAAGGAGATGGG + Intronic
1184161181 22:42698280-42698302 CAATGGAGACAGAAGGCCAAAGG + Intronic
1184533506 22:45071428-45071450 AAGTGGAGAGAGAGGGGGTAGGG + Intergenic
1184889956 22:47373606-47373628 GCGTGGAGCCAGGAGGAGAAGGG + Intergenic
1185168816 22:49279380-49279402 AAGAGGAAGAAGAAGGAGAAGGG - Intergenic
1203268954 22_KI270734v1_random:36737-36759 AAGTGGGGACACAGAGAGAAAGG + Intergenic
949122400 3:402423-402445 AAGTTGAGAGAGTAGCAGAAAGG - Intronic
949128839 3:477244-477266 AAGTGTATAGAGAAGGATAATGG - Intergenic
949808031 3:7976732-7976754 ATGTGGAGCCAGAAGGGGGATGG - Intergenic
949996880 3:9624759-9624781 AAGTAGATACTGTAGGAGAATGG - Intergenic
950005606 3:9689206-9689228 CAGTAGAGACAGCAGGAGCACGG - Intronic
950209878 3:11115133-11115155 TATTGGAGACTGCAGGAGAAAGG - Intergenic
950276118 3:11662563-11662585 TAGTGGAGGCAGTGGGAGAAGGG - Intronic
950342861 3:12263016-12263038 CAGAGGAGAGAGAAGGACAAAGG + Intergenic
950354115 3:12389527-12389549 AAATGGAAGCAGAAGGATAATGG + Intronic
950802107 3:15561167-15561189 AAGTACACTCAGAAGGAGAAGGG + Intronic
951388480 3:22072678-22072700 AAAAGGAGAAAGAGGGAGAAAGG + Intronic
951595269 3:24311955-24311977 AAGTGGAGAGAAGAGGAGCAAGG - Intronic
951795921 3:26538222-26538244 AAGGGGAAAGGGAAGGAGAAGGG + Intergenic
952181114 3:30917653-30917675 AACTCCAGTCAGAAGGAGAATGG - Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
952634154 3:35506256-35506278 AACTGGACACAGAATGAGATGGG + Intergenic
952967708 3:38631422-38631444 AAGTGGAAACAGAAAGTGAGAGG + Intronic
953139353 3:40213099-40213121 GAGTGGAGAAAGAATTAGAAGGG - Intronic
953199074 3:40761590-40761612 AAGAGGAAACACAAGAAGAAAGG + Intergenic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
953548283 3:43880908-43880930 AAGTTGAGTTAGAAGGGGAAGGG + Intergenic
953768899 3:45763886-45763908 ACGGGGACACACAAGGAGAAAGG + Intronic
953862925 3:46560798-46560820 ATGATGAGACAGAAGGAGAACGG + Intronic
953878253 3:46678625-46678647 AAGAGGAGAGAGATGCAGAAGGG + Intronic
953925559 3:46980675-46980697 AGGTGGAGTCAGAAGGTGAGGGG + Intronic
954142910 3:48619569-48619591 AAGGGGAAAAAGAAAGAGAAAGG + Intergenic
954147630 3:48642135-48642157 AAGTGGAGGTAGCAGCAGAAGGG + Intronic
955210533 3:56936277-56936299 AAGTGAAGGCAGAGAGAGAAGGG + Intronic
955949317 3:64226170-64226192 AAATGGAGACAACTGGAGAAAGG + Intronic
956365126 3:68493176-68493198 TCATGGAGACAGAAGTAGAATGG - Intronic
956882862 3:73528818-73528840 GAGTGGAGGAAGAAGGGGAATGG + Intronic
957350049 3:79012900-79012922 AAGTGGAGGGAGAAGGGGAAAGG + Intronic
957397210 3:79657468-79657490 AATTGGAGAAAAAAGGAGAAAGG + Intronic
957416910 3:79917361-79917383 AAGGGAAGAAAGAAGGAAAAAGG + Intergenic
957744825 3:84326409-84326431 AAGTGGAGACAGATGTAGCCAGG + Intergenic
958475814 3:94580243-94580265 AAGTGCAGATAGAAAGAAAAGGG - Intergenic
958729168 3:97942374-97942396 AAGTGGAGACTGAATAAAAATGG + Exonic
958878082 3:99638357-99638379 AAAGGGAGAGAGAGGGAGAAGGG - Intergenic
959012671 3:101096757-101096779 AAGAGGAGACAACAGCAGAACGG - Intergenic
959307589 3:104689010-104689032 GAGTAGAGACAGCAGAAGAAAGG - Intergenic
959993661 3:112656841-112656863 GAGTGGAGAGGGAGGGAGAAAGG - Intergenic
960165924 3:114401155-114401177 GGGAGGAGACAGAAGGAGAAAGG + Intronic
960236030 3:115283189-115283211 TAGTGGATAGAGCAGGAGAAGGG - Intergenic
960509205 3:118527754-118527776 AATTGAAGACAGAGAGAGAATGG + Intergenic
960689798 3:120333840-120333862 AAGTGGAGACAGAAGAGTATGGG - Intronic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
960921729 3:122753801-122753823 AAGTGGTGACAGAAAGAGCTGGG + Intronic
960942866 3:122945922-122945944 AAGTGGGGAGAGAAGGAGCCGGG + Intronic
960997792 3:123351169-123351191 AAGTGGAGACAGGTGGGGACTGG + Intronic
961122628 3:124385678-124385700 AAGTGGAGAAAGGAGAAGGAAGG + Intronic
961396834 3:126599364-126599386 AAGGAGAGAGAGAAGGAAAAAGG - Intronic
961546649 3:127639013-127639035 AAGGGGAGACAGATGGAGACAGG - Intronic
961554287 3:127687563-127687585 AAGTGGTGAGGGAATGAGAATGG - Intergenic
961563224 3:127745856-127745878 AAGTGGGGACAGAAGGCACAGGG + Intronic
961591481 3:127984910-127984932 AAGGGGATTCTGAAGGAGAATGG - Exonic
961709758 3:128819102-128819124 ATGTGGAGACACCAGGAGAGAGG - Intergenic
961893871 3:130151660-130151682 GAGTAGAGACACAAAGAGAAGGG + Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
962264423 3:133935131-133935153 AAGCAGAGCCAGAAGGAGAGAGG + Intronic
962600719 3:136989059-136989081 AAGTGGTGACAGGAGGGGCATGG + Intronic
962727768 3:138250123-138250145 AAGTGTAGACAGAAGAAAAAAGG + Intronic
962828912 3:139122741-139122763 ACATGGAGGCAGAAGGAGAATGG - Intronic
963508491 3:146217959-146217981 GAGAGGAGAGAGAAGGAGATGGG + Intronic
963550250 3:146711777-146711799 AAAAGGAGACAGAAGAGGAAGGG - Intergenic
963561283 3:146869149-146869171 AAGGGGAGAGAGAGGGAGCAGGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963716971 3:148813843-148813865 AAGTGGAGAAGGAAGAAGACTGG + Intronic
964113744 3:153113743-153113765 AAGAGGAGATGGAAAGAGAAAGG - Intergenic
964372899 3:156019718-156019740 AAGAAGAGAAAGAAGAAGAACGG + Intergenic
964590533 3:158358789-158358811 AAACGGAGACAGAGGGAGAATGG - Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965210249 3:165776974-165776996 AAGTGAAGATAAAAGGACAAGGG + Intronic
965722153 3:171673844-171673866 ATGTGGGGACAGAAGTAGGATGG - Intronic
966022448 3:175232109-175232131 AGAAGGAGAAAGAAGGAGAAGGG + Intronic
966321604 3:178707078-178707100 AAGTGGAGACAGAAGGAGAAAGG + Intronic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
966653866 3:182331139-182331161 AAGGTGAGACAGCAGCAGAAAGG - Intergenic
966954738 3:184864120-184864142 AAGAGGAAGGAGAAGGAGAAGGG + Intronic
967277141 3:187787222-187787244 AAGTGGAGACTGAAGGAAAATGG - Intergenic
967461812 3:189756715-189756737 GGGAGGAGACAGAAGGAAAAGGG - Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
967521227 3:190435281-190435303 ATGTAGAGACACAAGGAGAAGGG - Intronic
967743543 3:193029426-193029448 ATGTGGAGACAGAAGCCGAGGGG + Intergenic
967878076 3:194280228-194280250 AAATGGAGTTGGAAGGAGAAAGG + Intergenic
968130592 3:196190665-196190687 AAATGGAGACAGAAGAGAAAGGG + Intergenic
968683571 4:1939520-1939542 AAGTTAAGCCAGAAGGACAAAGG + Intronic
969233914 4:5851818-5851840 AGGAGGAGAAAGAAGGAGAAGGG + Intronic
969907632 4:10411671-10411693 AACTAGAGACAAAAGCAGAAAGG - Intergenic
969928081 4:10603958-10603980 AGGAGCAGAAAGAAGGAGAAAGG + Intronic
969979526 4:11140470-11140492 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
970054721 4:11957628-11957650 AAGTGCTGATAGAAGGAGATTGG - Intergenic
970122219 4:12768880-12768902 AATTGCAGACAAAAGCAGAATGG - Intergenic
970184376 4:13434161-13434183 AAGAGGAGACAGATGGAGTGGGG + Intronic
970430363 4:15983512-15983534 AAGAGGAGAGAGAAAGAGAAAGG + Intronic
970573358 4:17404285-17404307 AAGGGAAGGAAGAAGGAGAAAGG + Intergenic
971266329 4:25099153-25099175 AAGAGGAGAAAGAAGGAAAAGGG + Intergenic
971393714 4:26209662-26209684 AGGGGGAGACGGAAGGAGGAAGG - Intronic
971531972 4:27700417-27700439 AAAAAGAGACAGGAGGAGAATGG + Intergenic
971637408 4:29079270-29079292 CATTGGAGACAGAATGAGTATGG + Intergenic
971739418 4:30501515-30501537 AAGTGGGGAAAGAAAAAGAAGGG + Intergenic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972418225 4:38863304-38863326 AAGAGGACCCAGAAGGAGACTGG - Intergenic
972557821 4:40198233-40198255 AAGTGTCGGTAGAAGGAGAAGGG + Intronic
972664324 4:41149477-41149499 GGGGGGAGAAAGAAGGAGAAGGG + Intronic
972765667 4:42151225-42151247 AAATGGAGGAAGAAGGAGAAAGG + Intronic
973273941 4:48289217-48289239 ATGTGGAGAAAGCAGGAGCAAGG - Intergenic
973346185 4:49059059-49059081 AAGCAGAGAAAGAAGGAAAAAGG - Intronic
973745798 4:53962356-53962378 AAGGGGAGAAGGATGGAGAAAGG + Intronic
973783788 4:54316331-54316353 AAAAGCAGACAGAAGGAAAATGG - Intergenic
974028162 4:56752246-56752268 GAATGGAGACAAAAGGAGAATGG + Intergenic
974269731 4:59634416-59634438 AATTGGAGGCAGAAGGTGAAAGG + Intergenic
974524952 4:63038832-63038854 AAGAGCAGACAGGAGGGGAAGGG + Intergenic
974556840 4:63461645-63461667 AGCAGGAGAGAGAAGGAGAAGGG + Intergenic
974782259 4:66567863-66567885 AAGTGGAATCAGATGTAGAATGG + Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975114957 4:70670198-70670220 AACTTGAGACAGAAAGAGATTGG - Intronic
975283680 4:72592734-72592756 AAGTAGAGAAATAAGGAGAAGGG - Intergenic
975536922 4:75460707-75460729 AAGTGGAGAGGGAGGGAGGAAGG + Intergenic
976158327 4:82172002-82172024 AACTGGAGACAGAGGAAGGAAGG + Intergenic
976551638 4:86403062-86403084 ATGTTGAGTCAGAAGAAGAAAGG + Intronic
976713169 4:88094921-88094943 AATTGGGGAGAGAAGGAGGAAGG - Intronic
976727576 4:88229657-88229679 AAGTGGGGAGAAAAGGAGAATGG - Intronic
976919398 4:90419637-90419659 AAGAGGAGAGAGAAGCAGCAGGG + Intronic
976958778 4:90940321-90940343 AAAAGGAGAAAGGAGGAGAAGGG - Intronic
976960024 4:90958882-90958904 AAGTAGAGACAGAAGAAGGATGG - Intronic
977156784 4:93583760-93583782 AAGTGAGAACTGAAGGAGAATGG - Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977545352 4:98370476-98370498 GACTGGAGAAAAAAGGAGAAAGG - Intronic
977728649 4:100325858-100325880 AAAGGGAGAGAAAAGGAGAAAGG + Intergenic
977769221 4:100837299-100837321 ATGTGGAGAAAGAAAGAGAGAGG - Intronic
977912003 4:102548132-102548154 ATGTGGAGAAAGAGAGAGAAAGG + Intronic
978059242 4:104316015-104316037 CTGTGGAGACAAAAGCAGAATGG + Intergenic
978493996 4:109339834-109339856 AAGTGATGACAGATGGAAAATGG + Intergenic
978738594 4:112112495-112112517 AAATGGAGAAAAAAGGAGAAGGG + Intergenic
979346321 4:119591811-119591833 AAGATGAGAAGGAAGGAGAATGG + Intronic
979585225 4:122407540-122407562 AATTTAAGACAGAAGCAGAATGG + Intronic
979681590 4:123466165-123466187 AAGGGGAGACAGTGGAAGAAAGG + Intergenic
979746567 4:124221636-124221658 ATGTGAAGATAGAAGCAGAATGG + Intergenic
979774097 4:124565984-124566006 AAGTGGAGACAGCAGTGGCAAGG - Intergenic
980130736 4:128813195-128813217 AGGTGGAGAAAGGTGGAGAAAGG + Intronic
980301639 4:131003009-131003031 AATTGAAGACAGGATGAGAAGGG - Intergenic
980701045 4:136430540-136430562 AAGTGGACACAGCAGAATAAAGG + Intergenic
980992050 4:139746720-139746742 AAAGGGAGAGAGGAGGAGAAGGG - Intronic
981107966 4:140902968-140902990 CAGTGGTGCTAGAAGGAGAAAGG + Intronic
981637311 4:146895445-146895467 AAGTGAAGAATGAAGGAGAGAGG - Intronic
981818617 4:148860437-148860459 AAATGGAAACACCAGGAGAAGGG + Intergenic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982782795 4:159508572-159508594 AATTGGGGACAGAATGAGATGGG + Intergenic
983135170 4:164070114-164070136 AAGTGGGGAGAAAGGGAGAAGGG + Intronic
983535843 4:168855995-168856017 AAGTGGGGAGAGAAGGAGGTGGG - Intronic
983768952 4:171523769-171523791 AACTGGAGACAGAAGTGGGAAGG + Intergenic
984219025 4:176950662-176950684 AAGTGTTGACAGAAGCAGCAAGG + Intergenic
984297054 4:177865748-177865770 AAGTGGAGTGAGCAGGAGAGAGG + Intronic
984385040 4:179045373-179045395 AAGTGTAGACAGAAACATAAAGG + Intergenic
984418761 4:179492713-179492735 AGGTAGAGAGAGAAAGAGAAAGG - Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
984744744 4:183203482-183203504 GAGTGGATACAGAAGGACTATGG - Intronic
984765352 4:183396582-183396604 AAGTGGAAACAGAAACAGGAAGG - Intergenic
984836234 4:184024417-184024439 ACGTGGGGACTTAAGGAGAAGGG + Intergenic
985009420 4:185567358-185567380 AAGGAGAGACAGTAGGAAAATGG - Intergenic
985381080 4:189395565-189395587 AAATAGAGTCAGAAAGAGAAGGG - Intergenic
985385579 4:189444174-189444196 AAGGAGAAAGAGAAGGAGAAAGG - Intergenic
985819937 5:2152908-2152930 AAGGAGAGACAGAAGAAGAGAGG - Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
985857147 5:2437709-2437731 CAGCAAAGACAGAAGGAGAAGGG + Intergenic
986087749 5:4468602-4468624 AGGAGGAGAGAGGAGGAGAATGG - Intergenic
986181638 5:5398555-5398577 AACTGGAGACAGATGGATAAAGG - Intergenic
986201288 5:5581222-5581244 AAGTGGAAACAAAAGGTGAGAGG - Intergenic
986250403 5:6052438-6052460 AGGTGCAGACAGAAAGAGACTGG - Intergenic
986262382 5:6159787-6159809 AAGTGGAGAAGGCAGGAGATAGG + Intergenic
986353882 5:6905464-6905486 CACTGGAGACAGGTGGAGAATGG - Intergenic
986465380 5:8015992-8016014 AACTGGAGAAAGTGGGAGAAGGG + Intergenic
986729367 5:10623841-10623863 AAGTGGAGGAAGCAGGATAATGG - Intronic
986847280 5:11770192-11770214 AGGGAGAGACAGAAGAAGAATGG + Intronic
986854385 5:11851990-11852012 AACAGGAGATAGAAGGTGAAGGG - Intronic
988441199 5:31235481-31235503 AACTGGAGACAAAAGAATAAAGG - Intronic
988441925 5:31243263-31243285 AGGTGGGGACATGAGGAGAAGGG + Intronic
989094701 5:37771196-37771218 AAGTGCAGAAGGCAGGAGAAGGG + Intergenic
989503841 5:42202566-42202588 CAGTGAAGATAGAAGGTGAAAGG + Intergenic
989512979 5:42309881-42309903 ATGTGGGTAGAGAAGGAGAAAGG + Intergenic
989698139 5:44228440-44228462 GAGTGGAGACAGTTGGAAAAGGG + Intergenic
990005148 5:50937268-50937290 AAGGTGAGAGAGCAGGAGAAAGG + Intergenic
990077489 5:51867865-51867887 AAGAGGAGAAAAAAGTAGAAAGG + Intergenic
990352599 5:54933819-54933841 ATGAGGAGGGAGAAGGAGAAGGG - Intergenic
990847778 5:60163232-60163254 AAGTGGAGAGAGAATAACAATGG - Intronic
990849660 5:60188460-60188482 AGGAGGAGACAGATGGAGAAAGG - Intronic
991167527 5:63581714-63581736 AAGAGGAGAAGGAAGGAGCAGGG + Intergenic
991389396 5:66125993-66126015 AAGAGGAGACAGCTGGAGAAGGG + Intergenic
991615165 5:68489461-68489483 AGGAGGAGATAGAAGGAGGAAGG + Intergenic
992154895 5:73945379-73945401 AAGTGGAGAAAAAAAGAGACAGG + Intergenic
992162973 5:74020460-74020482 CAGTGGTGACAGAAAGAAAATGG + Intergenic
992530046 5:77644941-77644963 AAGGGGAGAGAGAAAGGGAAAGG - Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993470221 5:88298591-88298613 AAATGGAGACACCAGGAAAAGGG + Intergenic
993706167 5:91173135-91173157 AGATGGAGGCAGAAGCAGAATGG + Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994335011 5:98554422-98554444 AATTGGAGATTAAAGGAGAATGG - Intergenic
994377395 5:99030582-99030604 AAGAGGAGAAGGAAGGGGAAGGG - Intergenic
994498612 5:100544475-100544497 AAGAGGAGAAAGAAAGATAAAGG + Intronic
994782925 5:104116177-104116199 AAGGGGAAACAAAAGGAAAATGG + Intergenic
994936598 5:106260772-106260794 AAGAGGAGACAGAAGAAGAAAGG - Intergenic
995523071 5:113029125-113029147 AAGTGGTGACAGAAAGAGGAAGG + Intronic
995749563 5:115440063-115440085 TAGTAGAGTCAGAGGGAGAAGGG - Intergenic
995853124 5:116567594-116567616 AAATGAAAACTGAAGGAGAAAGG + Intronic
996285303 5:121783978-121784000 AGTTGGAGAAAGAAGGAGAGAGG + Intergenic
996387512 5:122925017-122925039 ATGTGGGGAGAGAAGGAGAAGGG - Intronic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997520469 5:134520767-134520789 AAGTGAACATAGAAAGAGAAGGG - Intergenic
997804627 5:136905018-136905040 AAGAAGAGAAGGAAGGAGAAAGG - Intergenic
997918720 5:137956385-137956407 ATATGGGGACAGCAGGAGAAGGG + Intronic
998261924 5:140638291-140638313 AAGTGGAGAGGAAAGGGGAAGGG + Intergenic
998277436 5:140770174-140770196 AAAGGGAGAGAGAAGGTGAAAGG - Intergenic
998419900 5:141974846-141974868 AAGTGGAGGCAGAAAGCAAATGG - Exonic
998454663 5:142262149-142262171 AAGTGGGGACAGATGCGGAAGGG - Intergenic
998581720 5:143384114-143384136 AGGAGGAGACAGAGAGAGAAGGG + Intronic
998667807 5:144318114-144318136 TTGAGGAGACTGAAGGAGAAGGG + Intronic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999658386 5:153832996-153833018 TAGTGGAGCCAGATGGTGAAAGG + Intergenic
1001013399 5:168118771-168118793 AAGAGAAGACAGAAAGACAAAGG - Intronic
1001043804 5:168355875-168355897 AAGTGGGGAGAGAAGGAGAGAGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001294500 5:170489481-170489503 ATATGGAGAAAGAAGGAGAGAGG - Intronic
1001405830 5:171476820-171476842 AAGCAGAGACACAAGGAGACTGG - Intergenic
1001445542 5:171779852-171779874 AAGGAGAGAGAGAGGGAGAAGGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1002169439 5:177367063-177367085 AAAGGGAGACAAAAGGAGCAGGG + Intronic
1002475712 5:179464583-179464605 ATGGGGAGCCAGAAGGGGAATGG + Intergenic
1003400300 6:5785150-5785172 CAGAGGATACAGCAGGAGAAGGG + Intergenic
1003473725 6:6461946-6461968 AAGTGGAGAAAGGAAGGGAAGGG + Intergenic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003660466 6:8056040-8056062 AAGTTAAGAGAGAAAGAGAAGGG - Intronic
1003727612 6:8783065-8783087 AAGAAGAGACACAAGAAGAAAGG + Intergenic
1003921993 6:10841087-10841109 GAGTGGAGAAAGAAAGAGTAGGG + Intronic
1004764736 6:18713464-18713486 GAGGGGAGACACGAGGAGAAAGG + Intergenic
1004794647 6:19067701-19067723 AGAGGGAGACAGAAGGAGACAGG - Intergenic
1004883409 6:20030646-20030668 AAGAGGAGACAGGAGAAGTAGGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005060703 6:21774514-21774536 AAGTGGGGAATGAGGGAGAAAGG - Intergenic
1005128993 6:22481719-22481741 AACAAGAGACAGAAGGAGAAAGG + Intergenic
1005709871 6:28493354-28493376 CAGTGGAGACACAAGTAGAAAGG - Intergenic
1005845452 6:29773419-29773441 AAGGAGAGAAAGAAGGAGAGAGG - Intergenic
1006180633 6:32151643-32151665 AGGGGGAGACAGAAAGAGGAGGG + Intronic
1006191783 6:32213890-32213912 AAGAGGAAAGAGAAGGAGAGCGG - Intronic
1006563458 6:34933977-34933999 AAATGGAGACGGGAGAAGAATGG + Intronic
1007118459 6:39361248-39361270 GAGTAGAGACACAAGAAGAATGG + Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008025403 6:46630256-46630278 AATGGCACACAGAAGGAGAATGG + Intronic
1008042862 6:46820290-46820312 AGGTGGAGGCAGAAGAAGCAAGG - Intronic
1008395414 6:51000884-51000906 AAGTGGAGAAGGAGGGACAAAGG - Intergenic
1008420322 6:51291701-51291723 ATGTGGAGACAGGAGGGGGATGG + Intergenic
1008458815 6:51743600-51743622 AATTAGAGAAAGAAGGAAAAAGG + Intronic
1009010191 6:57833171-57833193 AAATAAAGACAGAAAGAGAAAGG + Intergenic
1009372098 6:62917814-62917836 AAGTGGGGAGAGAAGGAGTGAGG + Intergenic
1009484476 6:64202752-64202774 AAGAGGAAAGAGAAGGGGAAAGG + Intronic
1009566549 6:65318242-65318264 AAGAGGAGTGAGAAGGGGAAAGG - Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009943268 6:70314502-70314524 AAGTGGAGCCAAAGGGAGACAGG + Intergenic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010266526 6:73874225-73874247 ACCTGATGACAGAAGGAGAAAGG - Intergenic
1011051024 6:83149761-83149783 AACAGGATAAAGAAGGAGAAGGG + Intronic
1011082542 6:83505535-83505557 AAGTTGAGACAAAAGGGGAAGGG + Intergenic
1011207604 6:84916894-84916916 CAGCGGAGTCAGAAGGTGAAAGG + Intergenic
1011419488 6:87156060-87156082 GATTGGAGAGAGTAGGAGAATGG + Intronic
1011733260 6:90287964-90287986 AAGTGAGCACAGAAGGAGGATGG + Intronic
1011863938 6:91796825-91796847 AAGTGCACAGAGAAGGATAATGG - Intergenic
1011871665 6:91901951-91901973 AAGAGGAGGAAGAAGGAAAATGG + Intergenic
1012130780 6:95489547-95489569 AAGTAGAGAAAGAAGGGAAAAGG + Intergenic
1012278572 6:97302046-97302068 GAGAGGAGACACAAAGAGAAAGG - Intergenic
1012923417 6:105243951-105243973 AAGTAGGGGAAGAAGGAGAAAGG - Intergenic
1013030496 6:106327809-106327831 AAGGGGAGAAAGAAAGAAAATGG - Intergenic
1013633083 6:112003774-112003796 AAGGAGAGAGAGAAAGAGAAGGG + Intergenic
1013922224 6:115419823-115419845 AAGTGGAAAGGGAAGGGGAAGGG + Intergenic
1014106605 6:117571446-117571468 TAGTAGAGACAGAAAGAGTAAGG - Intronic
1014151048 6:118055681-118055703 AAGTTGTGAGAAAAGGAGAAAGG + Intronic
1014163737 6:118200378-118200400 AAGTGGAAACACCAGGAGTAAGG + Intronic
1014403704 6:121022795-121022817 ATGTGGAGAGAGAAAGAGTAGGG + Intergenic
1014677234 6:124382265-124382287 GAGAGGAGAAAAAAGGAGAAAGG + Intronic
1015223774 6:130833276-130833298 GAGTGGAGAGAGAACTAGAATGG - Intronic
1015341287 6:132103939-132103961 AGGTGGAGAGAGAAGGGCAACGG + Intergenic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1015688561 6:135894558-135894580 AAATGGAGACAAAAGGAGAGAGG + Intronic
1015711759 6:136149243-136149265 AAATGGGGAAAGAAGGAAAAAGG - Intronic
1015901465 6:138072405-138072427 TTGTGGAGACAGAGGGAAAATGG + Intergenic
1016107403 6:140179693-140179715 AAGTGGAATCACCAGGAGAAGGG - Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016161323 6:140884000-140884022 AAGGGGAAGGAGAAGGAGAACGG - Intergenic
1016862189 6:148731829-148731851 AAGAGGAGGCAGAAGAAGAGGGG + Intergenic
1017123489 6:151045395-151045417 AAGTGGAGAGAGGGGGAAAAAGG - Intronic
1017160828 6:151364253-151364275 AAGTAAGGACTGAAGGAGAAGGG - Exonic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017272747 6:152528113-152528135 GAGAGGAGAAAGAAAGAGAAAGG - Intronic
1017339571 6:153305207-153305229 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339585 6:153305255-153305277 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017339626 6:153305405-153305427 AAGAGGAAGGAGAAGGAGAAGGG - Intergenic
1017367272 6:153658528-153658550 AAAAGGAGAGAGAAGGAGAGAGG + Intergenic
1017502415 6:155037850-155037872 CAGTGGACACAGAAGAAGTAAGG - Intronic
1017567364 6:155701722-155701744 GGGTGGAGAAAGGAGGAGAATGG + Intergenic
1017586939 6:155936875-155936897 AAATAGAGAGAGAAGGAGGAGGG + Intergenic
1017737775 6:157380468-157380490 AAGTGGAGACCGAAAGAGCTGGG + Intergenic
1017890741 6:158636785-158636807 AACTAGAGACAAAAGGAGAAAGG + Exonic
1018419564 6:163630353-163630375 CAGTGGGCACTGAAGGAGAAAGG + Intergenic
1018454735 6:163941642-163941664 TCCTGGAGACAGAAGGAGGAGGG + Intergenic
1018528628 6:164740377-164740399 AAATGGAGAGAGAAGCAGGACGG + Intergenic
1018613978 6:165668734-165668756 AAGAAAAGACAGAAAGAGAAAGG + Intronic
1018791699 6:167153707-167153729 AAGTGTGGACAGACGGTGAATGG - Intronic
1019546586 7:1580238-1580260 CATGGGAGACAGAAGGAGACAGG - Intergenic
1019584917 7:1794960-1794982 AAGTGGAGACAAAATGGAAAAGG + Intergenic
1019954601 7:4403374-4403396 AAGGGGAGAGAGAGAGAGAAGGG + Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020050342 7:5077126-5077148 AAGAAGAGAGAGAAAGAGAAAGG - Intergenic
1020055794 7:5116974-5116996 AGGTGGGGACAGAGTGAGAAAGG + Intergenic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021395012 7:20136743-20136765 AAGTTCATACAGAAGGAGGAGGG + Exonic
1021396769 7:20159005-20159027 AAGTAAAGACAGAAGGAGAAAGG - Exonic
1021408037 7:20296915-20296937 AAGTGGAAATATAAAGAGAAAGG - Intergenic
1021562511 7:21982525-21982547 CAGTGGAAACAGAAAGAGATTGG - Intergenic
1021626346 7:22596523-22596545 AAATAGAGACAGAAGTAGAAGGG - Intronic
1022014918 7:26341335-26341357 AAGGTAAGAGAGAAGGAGAATGG + Intronic
1022100031 7:27164067-27164089 AAGAGGACAGAGTAGGAGAAAGG - Intronic
1022255399 7:28651606-28651628 AAGTTGAAACAGAAATAGAAAGG - Intronic
1022636596 7:32142172-32142194 AAGAAAAGGCAGAAGGAGAAGGG + Intronic
1022670299 7:32449357-32449379 AAGAAGAGGAAGAAGGAGAAGGG + Intergenic
1023679266 7:42667513-42667535 AACAGGAGACAGAAGAAGAGGGG - Intergenic
1023718826 7:43072288-43072310 AAGAGGACAGAGGAGGAGAAAGG + Intergenic
1023724797 7:43131878-43131900 AGGAGGAGACAGAAGGACAAAGG - Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1024171384 7:46791232-46791254 AAGAGGAGAGGGAAGGGGAAGGG + Intergenic
1024213329 7:47226130-47226152 TAGTGTAGAGAAAAGGAGAAGGG + Intergenic
1024225790 7:47325872-47325894 AAGTGGAAACAGAAGGGTAGAGG + Intronic
1024254494 7:47530420-47530442 TAATGGAGACTGACGGAGAAGGG + Intronic
1024295989 7:47842721-47842743 CAGTGGAGACAGAAGGAGAAGGG + Intronic
1024439751 7:49403666-49403688 AGGAAGAGAGAGAAGGAGAAGGG + Intergenic
1024903284 7:54347031-54347053 AAATGGAGACACCAGGAAAAAGG - Intergenic
1024928594 7:54645150-54645172 ATGTGGAATGAGAAGGAGAAGGG + Intergenic
1024991784 7:55240435-55240457 AAGAAGAGGCAGAAGGAGAAAGG - Intronic
1025158262 7:56630049-56630071 AATTGGAGCCAGGAAGAGAATGG + Intergenic
1025277311 7:57594771-57594793 AAGTTCAGACTGAAGGGGAAGGG - Intergenic
1025705389 7:63858068-63858090 AAGTGGAGACACAGAGGGAATGG + Intergenic
1025757434 7:64357974-64357996 AATTGGAGTCAGGAAGAGAATGG - Intergenic
1025879347 7:65520008-65520030 AAGAGGAGAAGGAAGGAAAAAGG - Intergenic
1025885146 7:65582909-65582931 AAGAGGAGAAGGAAGGAAAAAGG - Intergenic
1026228476 7:68462986-68463008 AAGAGGAGAGAGAAGGAAAGAGG - Intergenic
1026905054 7:74058007-74058029 AAGGAGAAAGAGAAGGAGAAGGG - Intronic
1027195506 7:76027302-76027324 AAGAGGGGACAGGAGGGGAATGG + Intronic
1027366111 7:77460112-77460134 AAGAGGCCACAGTAGGAGAATGG + Intergenic
1027706068 7:81535357-81535379 AAGTGGAGGCAGAACGAGTGTGG - Intergenic
1027857246 7:83527396-83527418 AGGTGGACAAATAAGGAGAAAGG + Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1028006488 7:85575952-85575974 ATGTTGAGAGAGAAGGAGAAAGG + Intergenic
1028737807 7:94237166-94237188 GAGTTGACACAGCAGGAGAAGGG + Intergenic
1029165294 7:98584982-98585004 AAAGGGAGACAGAGGAAGAAAGG - Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029609089 7:101617114-101617136 ACATGGTGACAGAAGGGGAAAGG - Intronic
1030002726 7:105082619-105082641 CAGGGGTGACAGAGGGAGAAGGG + Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030528289 7:110679738-110679760 AAGTAGAGACAAAAGAGGAAAGG - Intronic
1030797819 7:113810538-113810560 TAATGGAGACAGAATGAGCAGGG + Intergenic
1031020287 7:116620451-116620473 AAGTGGAGACTGAAGAAGGAAGG + Intergenic
1031348050 7:120693569-120693591 AAGTGGAGGAAGAGGGAAAAAGG + Intronic
1031385819 7:121149727-121149749 AACTGGACACAGAAATAGAAAGG + Intronic
1031929876 7:127674149-127674171 AAGTGGGGACGGAAGGAGGGAGG - Intronic
1032312915 7:130804934-130804956 AAGTAGAGACAGTTGTAGAAAGG + Intergenic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1032446761 7:131990901-131990923 AAGTGGACAAGGAAGGACAAAGG + Intergenic
1032503234 7:132415626-132415648 AGGAGGAGAAAGAGGGAGAAAGG - Intronic
1032526764 7:132583708-132583730 AAATAGGGCCAGAAGGAGAATGG - Intronic
1032553857 7:132811515-132811537 AAGTGGAGGCAGAAATTGAAAGG - Intronic
1033130281 7:138740124-138740146 GAGAGGGGACAGAAGGGGAAAGG + Intronic
1033288121 7:140059928-140059950 AGGAGGAGACAGCAAGAGAAAGG + Intronic
1033478691 7:141716460-141716482 AAGAGAGGGCAGAAGGAGAAGGG - Intronic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033804384 7:144937574-144937596 AAGCGGAAAGAGAAGGGGAAGGG - Intergenic
1033883703 7:145918119-145918141 AAGAGAAGAAAGAAAGAGAAAGG + Intergenic
1034210335 7:149357670-149357692 AAGAGAAGAGAGAAGGAGAGAGG - Intergenic
1034696136 7:153055629-153055651 AAGTGCAGATAAATGGAGAAGGG - Intergenic
1035237678 7:157509233-157509255 GAGGGGGGAGAGAAGGAGAAGGG + Intergenic
1035242943 7:157543987-157544009 AGGTGGAGAGAGATGGAGAGCGG + Intronic
1035242948 7:157544027-157544049 AGGTGGAGAGAGACGGAGAGAGG + Intronic
1035242951 7:157544047-157544069 AGGTGGAGAGAGACGGAGAGAGG + Intronic
1035242954 7:157544067-157544089 AGGTGGAGAGAGACGGAGAGAGG + Intronic
1035242960 7:157544107-157544129 AGGTGGAGAGAGATGGAGAGAGG + Intronic
1035242968 7:157544157-157544179 AGGTGGAGAGAGACGGAGAGAGG + Intronic
1036012166 8:4738393-4738415 AAATGGTGGCAGAAGGAGAAGGG + Intronic
1036073407 8:5467741-5467763 AAAGGGAGAAAGAAAGAGAAAGG - Intergenic
1036149230 8:6282706-6282728 ATGTAGAGACATAGGGAGAAAGG + Intergenic
1036645623 8:10610156-10610178 AAGAAGGAACAGAAGGAGAAGGG - Exonic
1037115385 8:15219678-15219700 AAGTGAATACAGAAGGAAACAGG + Intronic
1037264871 8:17047416-17047438 AGGAGGAGAGAGAATGAGAAAGG + Intronic
1037315885 8:17599084-17599106 ATGTGGATAAAGAGGGAGAAGGG - Intronic
1037612038 8:20483994-20484016 AAAAGGACACAGAGGGAGAAAGG - Intergenic
1037671143 8:21016327-21016349 AAAGGGAGAGAGAGGGAGAAGGG - Intergenic
1037693887 8:21207246-21207268 AAGAGGAGAAAGGAGGAGAATGG - Intergenic
1037859302 8:22393262-22393284 AAGAGGAGGCAGGGGGAGAATGG + Intronic
1037974289 8:23199165-23199187 AAGTGGAGCCTGAGGGAGATGGG - Intronic
1038216558 8:25567057-25567079 AAGTAGAGAAGGAAGGGGAAAGG + Intergenic
1038217658 8:25577512-25577534 AAGTGGGCACAGAGCGAGAAGGG - Intergenic
1038384631 8:27130741-27130763 AGATAGAGAGAGAAGGAGAAAGG + Intergenic
1038544354 8:28413627-28413649 AAGAAGAGAGAGAAGGAGAAAGG - Intronic
1038659675 8:29486330-29486352 GAGTGGAGAAGGATGGAGAATGG + Intergenic
1038941085 8:32306710-32306732 TAATGGAGAAAGGAGGAGAAAGG + Intronic
1038947768 8:32380091-32380113 ATGTGGAGATAGAAGCAAAAAGG - Intronic
1039118442 8:34118535-34118557 AAGAGGAGAGAGAAAAAGAAGGG - Intergenic
1039498288 8:37997624-37997646 AAAGAGAGACAGAGGGAGAATGG - Intergenic
1039516601 8:38139022-38139044 ACGTGGAGACAGAAGTGGATGGG + Exonic
1040894778 8:52354761-52354783 AAGTTGAGCAAGAAAGAGAAGGG + Intronic
1040942275 8:52845584-52845606 AAGTGCAGAAAGACGCAGAAAGG - Intergenic
1041012844 8:53560439-53560461 AGTTGGAGACAGTAGAAGAAAGG - Intergenic
1041245502 8:55885042-55885064 AAGTGGGGAGAGCAGAAGAAGGG - Intronic
1042025064 8:64414589-64414611 ATTGGGAGACAGAGGGAGAAGGG - Intergenic
1042059785 8:64803882-64803904 AAGAAGAGAAAGAAGAAGAAAGG + Intergenic
1042205944 8:66329741-66329763 AGGTGGAGAGTCAAGGAGAAGGG - Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1042673458 8:71289244-71289266 AAGTGGAAAATGAGGGAGAATGG + Intronic
1042685206 8:71431167-71431189 AAGTGCAAAGAGAAAGAGAAAGG + Intronic
1042690352 8:71491583-71491605 ATGTGAAGACACAAGGAGAGGGG + Intronic
1042819225 8:72911929-72911951 AAGGGGAAACAGAAAGACAATGG - Intronic
1043227204 8:77747390-77747412 AAGAGGAGACAAAAGAAAAAAGG + Intergenic
1043760570 8:84062977-84062999 AAGTGGAGAAAAAAGCAAAAGGG - Intergenic
1043760585 8:84063127-84063149 AAGTGGAGAAAAAAGCAAAAGGG - Intergenic
1044180705 8:89190798-89190820 AAGAGGAGGGAGGAGGAGAAGGG + Intergenic
1044402224 8:91786119-91786141 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1044402229 8:91786137-91786159 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1045005276 8:97911997-97912019 AAGAGGAAACTGAAGGAGAGAGG + Intronic
1045023138 8:98061797-98061819 AGGAGGAGAAAGAAGGAGAGAGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045697892 8:104831275-104831297 ACGAGGAAACAGAAGGAAAAGGG + Intronic
1045735551 8:105292532-105292554 AAGTGGATAAAGAAGGAAAGTGG + Intronic
1046504090 8:115114901-115114923 AAGAAGAGAAAGAAGGAGAATGG - Intergenic
1046938467 8:119908089-119908111 AAGTGGAGGCCGAAGGAGTCCGG + Intronic
1047113669 8:121817886-121817908 AAGTGGAGAGGAAAGGGGAAAGG - Intergenic
1047184094 8:122616444-122616466 ATGTGGTGACAGAAGGAGGCAGG - Intergenic
1047544464 8:125802480-125802502 AGGGGGAGAGAGAAGGAGAAGGG + Intergenic
1047767772 8:128003306-128003328 CAGAGGAGACAGAAGGGGAGGGG - Intergenic
1048074253 8:131052022-131052044 AAGAGGAGAGAAAAGGAGAGAGG + Intergenic
1048171086 8:132107103-132107125 AAATAGATACAGAAGAAGAAGGG - Intronic
1048337869 8:133516289-133516311 AAGTTGTGGCAGAAGAAGAAGGG - Intronic
1048384623 8:133900505-133900527 AACTGGAGACAACAGAAGAAAGG + Intergenic
1048773287 8:137918841-137918863 CAGGAGAGAGAGAAGGAGAAGGG - Intergenic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1048853730 8:138669054-138669076 AGCTGGAGTCTGAAGGAGAAGGG + Intronic
1048869726 8:138787304-138787326 AAGAAGAGAGAGAAAGAGAAGGG + Intronic
1049269886 8:141689313-141689335 AAGTGATGACTGGAGGAGAAAGG + Intergenic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049474885 8:142792482-142792504 AAGTGTAGATGGAAGGAGGATGG - Intergenic
1049581625 8:143414109-143414131 AAAAGGAGTCAGAAAGAGAAAGG + Intergenic
1050019695 9:1270054-1270076 AAAAAGAGACAGAAGGAGAGAGG - Intergenic
1050041342 9:1496951-1496973 AAGGGGAGAGAGAGGGGGAAGGG - Intergenic
1050213092 9:3287048-3287070 AAGGGGAGGCACATGGAGAATGG - Intronic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1050725699 9:8645640-8645662 AAAAGGAGAGAGAAGAAGAAAGG + Intronic
1050858688 9:10395994-10396016 AGCGAGAGACAGAAGGAGAAAGG + Intronic
1050929736 9:11308165-11308187 CAGAGGAGGAAGAAGGAGAAAGG - Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051191195 9:14515272-14515294 AAGTGGAGAAGGAAGAAAAAGGG + Intergenic
1051839858 9:21383421-21383443 AAGTGGAGAAAGAAATAAAATGG - Intergenic
1052037701 9:23701634-23701656 AAGAGGGAACAGAAGGAGAAGGG + Intronic
1052072251 9:24095548-24095570 AGGTGGAGACAAAAAGGGAAAGG + Intergenic
1052216813 9:25976050-25976072 AAGGGGAAGCAGAAGGTGAAGGG - Intergenic
1052294103 9:26878603-26878625 AAGTGGAGGAAGATGGAGAATGG - Intronic
1052364806 9:27600204-27600226 AAGTGGTGACAGAATTAGAAGGG - Intergenic
1052514069 9:29457226-29457248 AAATGAAGACAAAGGGAGAAGGG + Intergenic
1053007411 9:34613228-34613250 AGGTGGACACAGAAGAAAAAAGG - Intergenic
1053786034 9:41653497-41653519 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054159016 9:61660699-61660721 AGGTGGAGACAGAAGGAGTCAGG + Intronic
1054174750 9:61867430-61867452 AGGTGGAGACAGAAGGAGTCAGG - Intergenic
1054478790 9:65591704-65591726 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1054662788 9:67713363-67713385 AGGTGGAGACAGAAGGAGTCAGG + Intergenic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055189658 9:73502348-73502370 AAGTGGGGAGAGAAAGAGGAAGG - Intergenic
1055870548 9:80873435-80873457 AAGTGTACAAAAAAGGAGAAGGG - Intergenic
1055883720 9:81033788-81033810 AAGTGGGGAAGAAAGGAGAAAGG + Intergenic
1056121735 9:83495049-83495071 AATTGGAAACAGTAGGAGAATGG - Intronic
1056315311 9:85383020-85383042 AAGTGGAGACATTTGGAGGAGGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057045454 9:91882789-91882811 ACGTGAAAACAGAGGGAGAAAGG + Intronic
1057081790 9:92178995-92179017 GAGTGGAGACAAAAGGAAGAAGG + Intergenic
1057193532 9:93100718-93100740 AGGTGTGGGCAGAAGGAGAAAGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1057778314 9:98028551-98028573 AAGAGGAGAGAGAAGGTGAGAGG + Intergenic
1057873523 9:98735592-98735614 AAGTGGAAGCAGAAGGCTAATGG - Exonic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058711524 9:107683468-107683490 AAGGGGATGCAGAGGGAGAAGGG - Intergenic
1058945736 9:109854233-109854255 AAGAGGAGACATAAGAAGAAGGG + Intronic
1059011660 9:110467957-110467979 ACGTGGAGAAAGTAGGAGCAAGG - Intronic
1059032755 9:110717574-110717596 AATTGGAAACAGAAGAAAAAAGG - Intronic
1059509164 9:114827970-114827992 AAGTGGGGAAGGAAGGAGGAAGG - Intergenic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059588333 9:115630174-115630196 AGGTGGAGAAAGAAAGAGGAAGG + Intergenic
1059761248 9:117339761-117339783 AGGTGAAGGAAGAAGGAGAAAGG + Intronic
1060056952 9:120422354-120422376 AATTGGGGTCAGAATGAGAAAGG + Intronic
1060218306 9:121751529-121751551 AAGTGGAGGGAGAGGCAGAATGG + Intronic
1060389527 9:123267363-123267385 AGGTGGGGACAGTAGGAGAAGGG - Intronic
1060518323 9:124279605-124279627 AAGTGAAGTCAGAAAGAGAAAGG - Intronic
1060555781 9:124506620-124506642 GATTGGAGATAGAGGGAGAAGGG - Intronic
1060872356 9:127053016-127053038 AAGTATAGACAGTAAGAGAAAGG - Intronic
1061156189 9:128863197-128863219 AAGTAGACACACAAGGAGGAGGG + Intronic
1061558838 9:131389569-131389591 TAGTGGTGACAGTAGGGGAAGGG + Intergenic
1061634843 9:131901006-131901028 GAGGGGAGACACAAGGAGAGGGG + Intronic
1061942745 9:133891974-133891996 AGGTGGAGAGAGAGGGAGAGAGG + Intronic
1061996611 9:134189353-134189375 AGGGAGAGACAGAAGGAGAGTGG + Intergenic
1062638420 9:137503624-137503646 AGGAGGAGGGAGAAGGAGAAGGG + Intronic
1062638426 9:137503643-137503665 AGGGGGAGGAAGAAGGAGAAGGG + Intronic
1203628372 Un_KI270750v1:47366-47388 AAGTTCAGACTGAAGGGGAAGGG - Intergenic
1185545384 X:939571-939593 AAGAGGAGACAAGAGGGGAAGGG - Intergenic
1185550083 X:976007-976029 AAGAGGAGGCAGAGAGAGAAGGG + Intergenic
1185573326 X:1151555-1151577 AAGAGGAGAGAGAAAGAGAGAGG + Intergenic
1185622729 X:1463443-1463465 ACGTGGAGACAGAGGCAGACTGG - Exonic
1185623868 X:1469056-1469078 AAGGGGAGAGGGAAGGAGAGGGG - Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185814482 X:3142347-3142369 AAGAGAAGAAAGAAGAAGAAAGG + Intergenic
1185954816 X:4478071-4478093 AAGAAGAGACAGATGAAGAAAGG + Intergenic
1185970962 X:4663109-4663131 GAGAGGGGACAGAACGAGAATGG + Intergenic
1186014880 X:5180150-5180172 AAAGGGAGAGAGAAGGAGACAGG + Intergenic
1186031930 X:5377639-5377661 GAGTGGAGGGAGAGGGAGAAAGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186129020 X:6446349-6446371 AAGAGCAAACAGAAGGGGAAGGG - Intergenic
1186208345 X:7223978-7224000 TAGTTGAAAGAGAAGGAGAAAGG + Intronic
1186230155 X:7445077-7445099 CTGTGGTGACAGAAGGGGAAGGG - Intergenic
1186243460 X:7594346-7594368 AAGTGCCTACAGAAGGAAAAAGG + Intergenic
1186253682 X:7697271-7697293 AAGTGGAGATTGAACGAAAAAGG - Intergenic
1186424839 X:9455700-9455722 AAGTAGAAAGAGAAGGAGAAAGG - Intergenic
1186463477 X:9766084-9766106 AAGTGGAAGGAGAAGCAGAAAGG + Intronic
1186468642 X:9804174-9804196 AGGTGGAGGCTGAAGGAGCATGG + Intronic
1186667578 X:11733889-11733911 AAGTTGAGACTGAAACAGAATGG - Intergenic
1186844503 X:13517356-13517378 AAGAGGAGAGAGAAAAAGAAGGG - Intergenic
1187648543 X:21375129-21375151 AGCTGGAGACAAAAGGAGACCGG - Intronic
1187696156 X:21923157-21923179 AAGGAGAGAAAGAAAGAGAAAGG + Intergenic
1187843796 X:23515450-23515472 AAGGGGAAGGAGAAGGAGAAGGG - Intergenic
1187847286 X:23553495-23553517 AGGTGAAGACAAGAGGAGAATGG + Intergenic
1188115899 X:26242014-26242036 AAGGGGAGAGAGAAGTAAAAAGG - Intergenic
1188558533 X:31440489-31440511 AAGAGGAGACAAAAAGAGCATGG + Intronic
1189181414 X:39008232-39008254 AAAGGGAGAGAGAAAGAGAAGGG + Intergenic
1189220215 X:39365344-39365366 AAGTGGAGACACCAGGACTAAGG + Intergenic
1189402681 X:40686981-40687003 AAGAGTATACAGAAGGAGATGGG - Intronic
1189494139 X:41493900-41493922 GAGTGGAGGCAGAAGAAGATTGG + Intergenic
1189997023 X:46648739-46648761 AAGTTGAGGAAGAAGGAGAGCGG + Exonic
1190101606 X:47526422-47526444 AAATGAAGACAGAAGAAGGAAGG - Intergenic
1190472924 X:50800721-50800743 GACTGGAGCCAGATGGAGAATGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190727458 X:53198931-53198953 AAGTGGGGCAAGAAGGAGGATGG - Intronic
1190776702 X:53558421-53558443 AACTGGAGCCAGAAGCAGAATGG - Intronic
1191026056 X:55914674-55914696 AAGTTGAGAAAGAAGGAGCATGG + Intergenic
1191126768 X:56964132-56964154 AATTGGACTCAGAAAGAGAAAGG + Intergenic
1191715372 X:64190467-64190489 AAGAGGAGGAAGAAGGAGAATGG - Exonic
1191715580 X:64191607-64191629 CAATGGAGACAGAGGAAGAACGG - Exonic
1191792004 X:64981007-64981029 TAGTGGAGACATAAGGAGTTGGG + Intronic
1192012119 X:67285684-67285706 CAGAGGAGACAAAAGGAAAAGGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192102929 X:68284391-68284413 CAGTGGTGGCAGAAGAAGAAAGG - Intronic
1192546996 X:72022511-72022533 AAGTGAGGACACAAGGAGAAGGG - Intergenic
1192894566 X:75428001-75428023 AACTGAAGAAAAAAGGAGAAGGG - Intronic
1193508363 X:82370635-82370657 AAGGGGAGAGAGAGGGAGAGGGG + Intergenic
1193521303 X:82532675-82532697 AAATGAAGACAGAAGAAAAATGG + Intergenic
1193715717 X:84933828-84933850 AAGTGGTGAGAGAAGGGGAGGGG + Intergenic
1194301817 X:92196831-92196853 AGGTGGAGAGAGAATGAGAGAGG + Intronic
1194431396 X:93811289-93811311 AAGGGGAAATAGAAGGAGAAAGG - Intergenic
1194631286 X:96288204-96288226 AAGTGGTGACTGAAGTAGAATGG - Intergenic
1195571716 X:106404272-106404294 AAGAGGGGAGAAAAGGAGAAGGG - Intergenic
1195611310 X:106870461-106870483 ATGTGGCGAGAGAGGGAGAAAGG - Intronic
1195766963 X:108306331-108306353 AAGTGCAGGCAGCTGGAGAAAGG + Intronic
1195948814 X:110245265-110245287 AGGGGGTTACAGAAGGAGAAGGG - Intronic
1196058017 X:111377096-111377118 AAGTGGAGGCAGGAGGAGGAGGG - Intronic
1196414134 X:115453318-115453340 ACGTGGAGCAAGAAGGAAAATGG + Intergenic
1196518669 X:116646070-116646092 GGGTGGAGACAGAAAAAGAAAGG - Intergenic
1196650046 X:118159286-118159308 AAGGGGAGAGAGAAAGAGAAAGG + Intergenic
1196755187 X:119151234-119151256 AGATGGAGACAGAGGGAAAAGGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197430056 X:126351187-126351209 AGGTGGAGAGAAAAGGAGGAGGG + Intergenic
1197503403 X:127270489-127270511 AAGTGGAGAAAGAACAAGGAGGG - Intergenic
1197766602 X:130063394-130063416 GAGTGGTGGCAGAAGGAGCAGGG + Intergenic
1198308215 X:135403358-135403380 AAGGGGAGAGAGGAAGAGAAGGG - Intergenic
1198999692 X:142620153-142620175 AAAGGGAGAGAGAAGGGGAAAGG + Intergenic
1199386873 X:147233165-147233187 AGAGGGAGAGAGAAGGAGAAGGG - Intergenic
1199568589 X:149245036-149245058 AAGTGGAGAGAGAAAGATTAGGG - Intergenic
1199899687 X:152160780-152160802 ATGTGGAGAAATAAAGAGAAAGG + Intergenic
1200257618 X:154592865-154592887 AAAAGGAGACACAAGAAGAAAGG - Intergenic
1200379716 X:155822221-155822243 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200379724 X:155822245-155822267 AAGGGGAAGGAGAAGGAGAAGGG + Intergenic
1200852833 Y:7903518-7903540 AATTGGAGACAGGAAGAGAATGG + Intergenic
1201321100 Y:12699363-12699385 AAGAGGAGAGAGGAGGAAAAAGG + Intergenic
1201622992 Y:15980943-15980965 AAGAAGAGAGAGAAGGAGAGTGG + Intergenic
1201697037 Y:16837419-16837441 ACGTGGAGAAAAAAGGTGAATGG - Intergenic
1202110857 Y:21417902-21417924 AAGTGAGGACAGAGGGAGAGGGG + Intergenic
1202117596 Y:21486279-21486301 AAGTTGGGACAGAAGGAGAGGGG - Intergenic
1202269858 Y:23061116-23061138 AATTGGAGACAGGAAGAGAATGG - Intergenic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202422852 Y:24694862-24694884 AATTGGAGACAGGAAGAGAATGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202447937 Y:24975224-24975246 AATTGGAGACAGGAAGAGAATGG + Intergenic