ID: 966323194

View in Genome Browser
Species Human (GRCh38)
Location 3:178723934-178723956
Sequence CATGGTAAACATACAAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 6, 3: 88, 4: 345}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966323191_966323194 16 Left 966323191 3:178723895-178723917 CCTAGGTTGAATCTATGTCTTTG 0: 2
1: 71
2: 669
3: 1198
4: 1419
Right 966323194 3:178723934-178723956 CATGGTAAACATACAAGTGCAGG 0: 1
1: 0
2: 6
3: 88
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966323194 Original CRISPR CATGGTAAACATACAAGTGC AGG Intronic
903727977 1:25466061-25466083 GGCAGTAAACATACAAGTGCAGG + Intronic
906361207 1:45161206-45161228 AATGATAAACATCCAAGTGCAGG + Intronic
906829509 1:49016555-49016577 CATGTTAAAGACACAAGTGATGG + Intronic
906957331 1:50385881-50385903 CCTGGTAAAAATGCCAGTGCAGG - Intergenic
908024993 1:59940651-59940673 AGTGGTAAACATACAAATGCAGG - Intergenic
908884677 1:68774862-68774884 TGTGATAAACATACTAGTGCAGG - Intergenic
909322421 1:74306327-74306349 TATGATAAACATATGAGTGCAGG + Intronic
909743376 1:79061544-79061566 TGTGATAAACATACAAGTGCAGG - Intergenic
911136118 1:94442914-94442936 TATGATAAACATACCAGTGCAGG + Intronic
911614932 1:99999738-99999760 GATGGGAAAGATACAAGGGCAGG - Intronic
912100444 1:106197235-106197257 TACAATAAACATACAAGTGCAGG - Intergenic
915085275 1:153383775-153383797 TTTGATAAACATACTAGTGCAGG - Intergenic
917593859 1:176507478-176507500 AGTGATGAACATACAAGTGCAGG - Intronic
918576171 1:186063177-186063199 TCTGGTAAACATACTAATGCAGG + Intronic
918890840 1:190265369-190265391 TATGGAAAACAAACAAGTGAGGG + Intronic
918938872 1:190963373-190963395 TGTGGTAAATATACAAGTGCAGG - Intergenic
919262608 1:195217172-195217194 AATGGAAAACAAAAAAGTGCAGG + Intergenic
920894689 1:210034923-210034945 TATGATAAACATAGAAGTGCAGG + Intronic
921382981 1:214544083-214544105 TATGGTAAACTTACTAATGCTGG + Intronic
921407276 1:214794297-214794319 TGTGATAAACATACAATTGCAGG + Intergenic
922974648 1:229774044-229774066 TGTGATAAACATACGAGTGCAGG - Intergenic
922989429 1:229893868-229893890 AAAGGTAAACATCCAGGTGCTGG - Intergenic
923229883 1:231975510-231975532 TGTGATAAACATACAAGTGCAGG - Intronic
923397990 1:233586355-233586377 TGTGATAAACATACAAGTTCAGG - Intergenic
923417598 1:233778978-233779000 TGTGATAAACATACAAGTGCAGG + Intergenic
923697864 1:236272245-236272267 CGTGATAAACGTTCAAGTGCAGG - Intronic
924141766 1:241031426-241031448 TGTGATAAACATACAAGTGCAGG + Intronic
1064023801 10:11830477-11830499 CGCGGTAAAGATGCAAGTGCAGG + Intronic
1064266383 10:13828908-13828930 TGTGATAAACATACAAGTGCAGG + Intronic
1064939348 10:20715173-20715195 GATGGTAAACATCCTAGGGCTGG - Intergenic
1065700875 10:28424166-28424188 CTTGCTAAACAGACAAGTGAGGG - Intergenic
1065766399 10:29034209-29034231 TACAATAAACATACAAGTGCAGG - Intergenic
1065776449 10:29124990-29125012 CCTGGTAAACAACCATGTGCCGG - Intergenic
1066554864 10:36600876-36600898 TATACTAAATATACAAGTGCAGG + Intergenic
1067600743 10:47595580-47595602 AATGGAAAACATAAAAGAGCAGG + Intergenic
1068553300 10:58429880-58429902 GTTGATAAACATACAAGTGCAGG + Intergenic
1070399804 10:76043665-76043687 CATGGTAGATCTACAAGTGAAGG + Intronic
1070434494 10:76376519-76376541 TGTGATAAACATACAAGTGCAGG + Intronic
1070625138 10:78045702-78045724 CTTGTTAAAAATACAAATGCTGG + Intronic
1070988115 10:80705963-80705985 TATGATAAACATACAAGTGCAGG - Intergenic
1071105897 10:82094533-82094555 TGTGATAAACATACAAATGCAGG - Intronic
1071301518 10:84259337-84259359 TGTGATAAGCATACAAGTGCAGG + Exonic
1072483869 10:95835389-95835411 TGTGATAAATATACAAGTGCAGG + Intronic
1074210377 10:111327602-111327624 TGGGGTGAACATACAAGTGCAGG - Intergenic
1074247718 10:111711857-111711879 CATGGTATACATACAAGAAATGG + Intergenic
1074757822 10:116639202-116639224 TGTGATCAACATACAAGTGCAGG + Intronic
1075008825 10:118851131-118851153 CTTGGTAAAAATACATGTTCTGG + Intergenic
1076050247 10:127327680-127327702 CATGGTAAAGATACAAGAGATGG - Intronic
1076361604 10:129893626-129893648 CATGGTAAACAAAGACTTGCTGG + Intronic
1077885009 11:6380907-6380929 GATGGTAAAAAGACAAGTGCAGG + Intergenic
1078651815 11:13202279-13202301 TATGATGAACATACAAGTGCAGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079190783 11:18275162-18275184 CCTGTTAAAAATACAATTGCTGG - Intergenic
1079519147 11:21304156-21304178 CATGGTTATAATACAAGTGTCGG + Intronic
1079727577 11:23894948-23894970 TGTGATAAACATACATGTGCCGG - Intergenic
1079882812 11:25947005-25947027 AATGGAAAACATAAAAGAGCAGG + Intergenic
1080609267 11:33889833-33889855 TACGATAAACATACAAGTGCAGG - Intronic
1082230691 11:49762376-49762398 CATGGTAAACATCCAAAATCAGG + Intergenic
1082274761 11:50209297-50209319 TATGATAAACATACAAGTGCAGG - Intergenic
1082276470 11:50227345-50227367 CATGATAAACATACAGGTGAAGG - Intergenic
1082915652 11:58433545-58433567 TTTGATAAAAATACAAGTGCAGG - Intergenic
1083232197 11:61329881-61329903 CATGGAAAAAATTAAAGTGCTGG - Intronic
1086051106 11:82591514-82591536 TGTGATAAACATACAAGTACAGG + Intergenic
1086619358 11:88866597-88866619 CATGGTAAACATCCAAAATCAGG - Intronic
1087055475 11:93931821-93931843 TATGATAAACATCCACGTGCAGG - Intergenic
1087580420 11:100044278-100044300 CGTGATAAACATATGAGTGCAGG + Intronic
1088059040 11:105623167-105623189 TGTGATAAACATACAAGTGCAGG + Intronic
1088206005 11:107393575-107393597 TGGGATAAACATACAAGTGCAGG - Intronic
1094304350 12:29000885-29000907 CATGGTGAACATCCAAGGCCAGG + Intergenic
1094322118 12:29196147-29196169 TGTGATAAACATACAAGTGCAGG + Intronic
1094397140 12:30020109-30020131 TGTGATAAACATACAAATGCAGG - Intergenic
1094732202 12:33190905-33190927 TATGATAAACATGCAAGTGCAGG + Intergenic
1095816566 12:46429109-46429131 CATGGTAAGCATAGCAGTGCAGG - Intergenic
1096436861 12:51599052-51599074 CCTGTTAAAAATAAAAGTGCAGG + Intronic
1097152569 12:56990299-56990321 TGTGATAAACATACTAGTGCAGG - Intergenic
1097649991 12:62285735-62285757 TGTGATAAACATACAAGTGCAGG + Intronic
1098022082 12:66166835-66166857 CTTTGTAAACATCCATGTGCAGG - Intronic
1098185919 12:67896214-67896236 TGTGATAAGCATACAAGTGCAGG + Intergenic
1098787028 12:74772601-74772623 CTTGATAAGCATACAAGTGGAGG + Intergenic
1098817578 12:75187196-75187218 CATTGTAAATTTACAAGTGGAGG + Intronic
1099301725 12:80903631-80903653 TGTGATAAACATACAATTGCAGG + Intronic
1099358788 12:81671273-81671295 CATGGTGAACATACAAGAATAGG - Intronic
1099926492 12:89024885-89024907 TGTGATAAACATACAAATGCAGG + Intergenic
1102402692 12:112643857-112643879 TGTGATAAACATACAAGTGTAGG - Intronic
1105360917 13:19715354-19715376 CATGGTAAACATGCCACTACTGG + Intronic
1105669593 13:22597630-22597652 TGTGATAAACATGCAAGTGCAGG - Intergenic
1107966228 13:45600796-45600818 TATGATAAACATACAGTTGCAGG + Intronic
1108163056 13:47662911-47662933 TTTGATAAACATACAAGTGCAGG - Intergenic
1108882592 13:55139092-55139114 TATGATAAACATTCAACTGCAGG + Intergenic
1109057727 13:57573656-57573678 AATGGAAAACAAAGAAGTGCAGG - Intergenic
1109386831 13:61640764-61640786 CATGATAAACCCACAAATGCAGG + Intergenic
1109883171 13:68508294-68508316 TGTGATAAACATATAAGTGCAGG + Intergenic
1110059598 13:71025131-71025153 TGTGATAAACATACAAGTGCAGG + Intergenic
1110603818 13:77408197-77408219 TATGATAACCATACAAATGCAGG - Intergenic
1111956148 13:94760774-94760796 CATTGTAAACAAACAAGTTAAGG - Intergenic
1113707076 13:112441907-112441929 CATGGGAAACATGCACGTTCAGG + Intergenic
1114684578 14:24516425-24516447 TATGATAACCATACAAGTGCAGG + Intergenic
1115010050 14:28535412-28535434 AATGGTAAACAAAAAAGAGCAGG - Intergenic
1116011776 14:39359780-39359802 TGTGATAAACACACAAGTGCAGG + Intronic
1116202695 14:41819178-41819200 TGTGATAAACATACCAGTGCAGG + Intronic
1116369821 14:44116093-44116115 TGTGATAAACATACAAATGCAGG + Intergenic
1116635628 14:47390993-47391015 CATTGTAAATATGCAAGGGCTGG - Intronic
1116928012 14:50660907-50660929 CATGATAAACATGGGAGTGCAGG + Intronic
1117636530 14:57750341-57750363 TGTGGTAAACATAGGAGTGCAGG + Intronic
1120218581 14:81706878-81706900 CACAGTAAACATACGTGTGCAGG + Intergenic
1202829215 14_GL000009v2_random:8133-8155 CAAGATAAAGATACAAATGCAGG - Intergenic
1202900927 14_GL000194v1_random:37985-38007 CAAGATAAAGATACAAATGCAGG - Intergenic
1123766723 15:23487647-23487669 TGTGATAAACATACAAATGCAGG - Intergenic
1123803023 15:23841257-23841279 CATGATAAAGATACTAGTGCAGG - Intergenic
1123973421 15:25530088-25530110 TGTGATAATCATACAAGTGCAGG + Intergenic
1124357207 15:29004509-29004531 CTTGGTAAAAATACAAATGCAGG + Intronic
1125073907 15:35590488-35590510 TGTGATAAACATACATGTGCTGG + Intergenic
1125764899 15:42128110-42128132 TGTGATAAACATAAAAGTGCAGG + Intergenic
1128041057 15:64573747-64573769 CATGGTAAACCCACATATGCAGG - Intronic
1128399008 15:67257825-67257847 CATTGTTAACATACAATTGTTGG - Intronic
1129562938 15:76590729-76590751 TGTGATAAACATACAAGTGCAGG - Intronic
1130359315 15:83167191-83167213 AATGGAAAACATAAAAGAGCAGG + Intronic
1130582393 15:85150216-85150238 CATTGTAAACATTCATGTGAAGG - Intergenic
1131572910 15:93557235-93557257 TGTGATAAACATACAAGTACAGG + Intergenic
1133178892 16:4037510-4037532 TGTGATGAACATACAAGTGCAGG + Intronic
1134232446 16:12439240-12439262 CATGGTAGACATGCAGCTGCTGG - Intronic
1135506848 16:23045523-23045545 TGCGATAAACATACAAGTGCAGG - Intergenic
1136265827 16:29117500-29117522 CATGGTAAACAAACTCCTGCTGG - Intergenic
1136646812 16:31627184-31627206 AATGGTAAACAAAAGAGTGCAGG + Intergenic
1136772416 16:32852814-32852836 TGTGGTAAACATAGAAGTGTGGG - Intergenic
1136898199 16:34008703-34008725 TGTGGTAAACATAGAAGTGTGGG + Intergenic
1137007345 16:35289491-35289513 AATGGAAAACAAACAAATGCAGG + Intergenic
1137067085 16:35858129-35858151 TGTGATAAACATACATGTGCAGG - Intergenic
1137510796 16:49098351-49098373 CAGGATAAACATACAAATGCAGG - Intergenic
1138919318 16:61507997-61508019 TGTGATAAACATACAAGTACAGG - Intergenic
1139048267 16:63090092-63090114 TATGATAAACATACAAATGCAGG - Intergenic
1139142005 16:64276781-64276803 CATAATAAACATACAAATGCAGG - Intergenic
1140336521 16:74112102-74112124 TGTGATAAACATACAAGGGCAGG - Intergenic
1141332415 16:83123655-83123677 TATGATAAACACACAAGTGCAGG + Intronic
1203074838 16_KI270728v1_random:1114912-1114934 TGTGGTAAACATAGAAGTGTGGG - Intergenic
1144335341 17:14263911-14263933 TGTGGTAAACATATGAGTGCAGG - Intergenic
1145020452 17:19426433-19426455 CATGGCACACCTACAAGTGTCGG + Intergenic
1145353512 17:22112922-22112944 CATGGAAAATATAAAAGTGCAGG - Intergenic
1147900993 17:43784392-43784414 CATGGAAAAGATACAAGAGAAGG + Exonic
1150964735 17:69955335-69955357 TTTGATAAACATACAAGTGCAGG - Intergenic
1152794346 17:82299518-82299540 CATGGTAAAAATTCAAGAGGTGG + Intergenic
1153108388 18:1555157-1555179 TATAGTAAACATACGAGTGTAGG + Intergenic
1153499570 18:5734352-5734374 AGTGATAAACACACAAGTGCAGG - Intergenic
1154221211 18:12456065-12456087 CATGTTAAAAATTCAAATGCAGG - Intronic
1156132575 18:33995082-33995104 CATGGTAGACATATAAGTGTAGG + Intronic
1156895208 18:42238573-42238595 TGTGATAAACATACAGGTGCAGG + Intergenic
1157882992 18:51340001-51340023 TATGGTAAAAATACAAGAGATGG - Intergenic
1159302220 18:66588372-66588394 CATGATCATCATACAAATGCAGG + Intronic
1159712171 18:71774350-71774372 TATGATAAACATGCAAGCGCAGG + Intronic
1160332460 18:78007010-78007032 CATGGATAACATGCAAATGCAGG + Intergenic
1162202527 19:9031184-9031206 TGTGATAAACCTACAAGTGCAGG - Intergenic
1162712741 19:12608195-12608217 CAAGGTAAACATGCAAGAGACGG - Intronic
1164451677 19:28371537-28371559 AGTGGTAAACATACAACTGCAGG + Intergenic
1164598465 19:29545784-29545806 TATGATGAACATACAGGTGCAGG + Intronic
1165263767 19:34643100-34643122 TGTGATAAACATACAAGTGCAGG - Intronic
1166022534 19:40045512-40045534 TACAGTAATCATACAAGTGCAGG - Intronic
1166969035 19:46550199-46550221 TGCTGTAAACATACAAGTGCAGG + Intronic
1168562906 19:57398213-57398235 GATGGTAAGCATACAAGGGAGGG - Intronic
1202643480 1_KI270706v1_random:119656-119678 CAAGATAAAGATACAAATGCAGG + Intergenic
925616985 2:5753161-5753183 TGTGTTAAACATACAAGTACAGG + Intergenic
925679372 2:6401682-6401704 TATGATAAACATTTAAGTGCAGG + Intergenic
927169093 2:20353252-20353274 CATTGTAAATATCCAAGTGAGGG + Intergenic
927364574 2:22279142-22279164 TGTGATAAACATACAAGTGTGGG + Intergenic
928903573 2:36347617-36347639 CATAGTCAACAAACAAATGCAGG + Intergenic
929048225 2:37811678-37811700 TGTGGTAAACATGCAAGTGCAGG + Intergenic
930555497 2:52890354-52890376 TATGATAAACATATAAATGCAGG + Intergenic
932815700 2:74859862-74859884 TGTGATAAACATACAAGTGCAGG - Intronic
932880574 2:75498016-75498038 TACAGTAAACATACAAGTACAGG - Intronic
933475739 2:82788290-82788312 TGTGATAAACATACAAATGCAGG - Intergenic
935489705 2:103702427-103702449 TTTGATAAACATATAAGTGCAGG + Intergenic
937912709 2:127083405-127083427 CTGGGCAAACATACAAATGCAGG - Intronic
939810684 2:146828213-146828235 CATGGCAAACAGAAAAGAGCAGG + Intergenic
939831124 2:147072346-147072368 TGTGATAAACATAAAAGTGCAGG + Intergenic
941692912 2:168519878-168519900 TGTGATGAACATACAAGTGCAGG + Intronic
941997561 2:171615058-171615080 TGTGATAAACATACAAGTGCAGG - Intergenic
942629540 2:177940774-177940796 CACGGTATATATTCAAGTGCAGG - Intronic
943245666 2:185447581-185447603 TGCAGTAAACATACAAGTGCAGG - Intergenic
943391134 2:187269347-187269369 TGTGATGAACATACAAGTGCAGG + Intergenic
943606219 2:189980104-189980126 TGTGATAAACAGACAAGTGCAGG - Intronic
943638354 2:190331588-190331610 CATCATAAACATACAAGGGCAGG - Intronic
943901666 2:193446507-193446529 TATGATAAACATACAATTGCAGG + Intergenic
944346443 2:198671576-198671598 CACAGTAAACATACAAGTGAAGG - Intergenic
945390366 2:209258434-209258456 CATGGTAAAAAAAAAAGTACAGG + Intergenic
947616441 2:231560120-231560142 CATTGTAAACAAACAAGTTCAGG + Intergenic
1168747045 20:252654-252676 TGTAATAAACATACAAGTGCAGG + Intergenic
1169875312 20:10290930-10290952 CAAGGTAAATATTCAAGTGGAGG - Intronic
1170282098 20:14661000-14661022 TGGGGTAAAAATACAAGTGCAGG + Intronic
1171286319 20:23941625-23941647 TGTGATAAAAATACAAGTGCAGG - Intergenic
1171563767 20:26157122-26157144 CATGGAAAATATAAAAGTGCAGG - Intergenic
1171893450 20:30738595-30738617 CAAGATAAAGATACAAATGCAGG + Intergenic
1173044425 20:39495932-39495954 TATGATAAACATACAAGTACAGG - Intergenic
1173096516 20:40034885-40034907 AAAGGTAAAAATACAACTGCTGG + Intergenic
1173490526 20:43476367-43476389 TATGATAATCATACAAATGCAGG - Intergenic
1174725115 20:52853107-52853129 CTTGGAAAATAGACAAGTGCAGG + Intergenic
1174785912 20:53432423-53432445 TGTGATAAACATACATGTGCAGG + Intronic
1175462435 20:59161711-59161733 TGTGATAAACATACGAGTGCAGG + Intergenic
1176608399 21:8852973-8852995 CAAGATAAAGATACAAATGCAGG - Intergenic
1176620301 21:9052763-9052785 CAAGATAAAGATACAAATGCAGG - Intergenic
1177198973 21:17932498-17932520 CACAATAAACATACAAGTGCAGG - Intronic
1177448155 21:21225866-21225888 TATGATAAACATATAAATGCAGG - Intronic
1177450922 21:21264536-21264558 TATTATAAACATACAAGTCCAGG - Intronic
1178197399 21:30363099-30363121 TATGATAACCATACCAGTGCAGG - Intronic
1180358482 22:11862777-11862799 CAAGATAAAGATACAAATGCAGG - Intergenic
1180379780 22:12129553-12129575 CAAGATAAAGATACAAATGCAGG + Intergenic
1183031591 22:35110537-35110559 CATGGCAAACGTTCAATTGCTGG + Intergenic
1184883956 22:47330785-47330807 CAAGGTAAACATATCAGAGCAGG - Intergenic
1185007208 22:48287790-48287812 CATTGAAAAAATAAAAGTGCGGG + Intergenic
949753901 3:7386718-7386740 TGTGATAAACATTCAAGTGCGGG + Intronic
949754276 3:7391760-7391782 CATGGAAAAAAAACAAGAGCTGG + Intronic
950274989 3:11653033-11653055 CATGGTAAAAATAGAAGAACTGG + Intronic
951479587 3:23145452-23145474 CAGGGTAAAAATAAATGTGCAGG - Intergenic
952519059 3:34136923-34136945 TGTGATAAACATACCAGTGCAGG - Intergenic
953754997 3:45638600-45638622 GGTGATAAACATACGAGTGCAGG + Intronic
954105035 3:48405384-48405406 CACGGCCAACATGCAAGTGCAGG - Intronic
955676951 3:61458744-61458766 CATGTTGAAAATACAGGTGCTGG - Intergenic
956613712 3:71150423-71150445 CATGGTAAAAAGAGAAGTGGCGG - Intronic
957209733 3:77244352-77244374 CATGGTAAAAATACAACTGTTGG + Intronic
957563985 3:81861685-81861707 CAGGGTAAACATAAAAGAGAGGG + Intergenic
957592332 3:82215948-82215970 TGTGATAAACATACAATTGCAGG + Intergenic
958265268 3:91430796-91430818 TGTGATAAACATAAAAGTGCAGG + Intergenic
958452381 3:94289897-94289919 TATAATAAACATACAAGTACAGG + Intergenic
958569110 3:95857088-95857110 CACAATAAACATACATGTGCAGG - Intergenic
958811854 3:98868918-98868940 TATGATAAACATACTAGTGCAGG + Intronic
959719066 3:109467218-109467240 CACAGTAAACATAAAAGTGCAGG - Intergenic
960039880 3:113140107-113140129 CATGGTAAAGATAAAAGAGAGGG + Intergenic
960445803 3:117747133-117747155 CATGGAAGTCATACAAGTTCTGG - Intergenic
962591768 3:136896859-136896881 TACAGTAAACATGCAAGTGCAGG + Intronic
963177848 3:142320025-142320047 TGTGATAAACATACAAATGCAGG + Intronic
963402149 3:144812536-144812558 GATGGTCAACATAGAAGTGAAGG + Intergenic
963818530 3:149861321-149861343 CATAATAAACATGCAAGTGCAGG - Intronic
964527364 3:157629819-157629841 CATGGCAAATATACCACTGCTGG + Intronic
964929782 3:162002952-162002974 TATGATAAACATACAAGTAGAGG + Intergenic
965716434 3:171609417-171609439 TGTGATAAACATACAAGTGCAGG - Intronic
966323194 3:178723934-178723956 CATGGTAAACATACAAGTGCAGG + Intronic
966340502 3:178920537-178920559 TGAGATAAACATACAAGTGCAGG - Intergenic
966519917 3:180862076-180862098 TGCGGTAAACATTCAAGTGCAGG - Intronic
967045194 3:185730402-185730424 GATGATAAACATACAAGCGCAGG + Intronic
967470463 3:189854894-189854916 CATGGCAAACCTAAAATTGCAGG + Intronic
970310195 4:14774752-14774774 TGTGATAAACATACAGGTGCAGG - Intergenic
970799633 4:19957264-19957286 TGTGATAAACATATAAGTGCAGG - Intergenic
972128722 4:35802486-35802508 CAAGGTACACAAACAAGTGGAGG - Intergenic
972232291 4:37088344-37088366 TGTGATAAACATACAAGTGCAGG + Intergenic
972904184 4:43724418-43724440 CACAATAAACATACATGTGCAGG - Intergenic
972920642 4:43937054-43937076 TGTGATAAACATACAAGTGCAGG - Intergenic
973020732 4:45202797-45202819 TGTGATAAGCATACAAGTGCAGG + Intergenic
973096417 4:46206781-46206803 TGTGATCAACATACAAGTGCAGG - Intergenic
973577635 4:52306715-52306737 TGTGGTAAACATACAAGTGCAGG + Intergenic
974414567 4:61590526-61590548 CGTTGTAAACTTTCAAGTGCTGG - Intronic
974472957 4:62341505-62341527 TGTGATAAACATACAGGTGCAGG - Intergenic
975791109 4:77951984-77952006 TATGATAATCATACAAATGCAGG + Intronic
978075384 4:104522598-104522620 CACAATAAACATACATGTGCAGG + Intergenic
978483720 4:109225639-109225661 TCTGATACACATACAAGTGCAGG - Intronic
978554660 4:109966492-109966514 TGTGATAAACATACAAGTGCAGG + Intronic
979185620 4:117788255-117788277 CATGTTGAACAGACAAGAGCTGG - Intergenic
979300793 4:119084948-119084970 TGTGATAAACATACAGGTGCAGG - Intergenic
979405710 4:120308395-120308417 CTTGGTGAACATACAACTGGTGG + Intergenic
979454738 4:120914696-120914718 TGTGATAAACATACATGTGCAGG - Intronic
979784899 4:124704320-124704342 CCTTGAAAACATACAAGTGAGGG + Intronic
980100443 4:128536510-128536532 TATAATAAACATGCAAGTGCAGG + Intergenic
980222286 4:129934325-129934347 CATGGTAAACAAGGAAGTTCAGG + Intergenic
980334404 4:131451934-131451956 TATGGTAAACATTCTAGTGCAGG + Intergenic
980378607 4:131979236-131979258 TGTGATAAACATACAGGTGCAGG - Intergenic
980506520 4:133731325-133731347 CATGGCTAAAATATAAGTGCCGG - Intergenic
980875222 4:138655501-138655523 CATGGTAAACAGACTGGTACAGG + Intergenic
981165935 4:141556964-141556986 TGTGATAAACATATAAGTGCAGG + Intergenic
981438949 4:144760288-144760310 TGTGATAAACATACATGTGCAGG - Intergenic
982608541 4:157544033-157544055 TGCGATAAACATACAAGTGCAGG + Intergenic
983423008 4:167544717-167544739 TATGATAAACATACAAGTGTAGG + Intergenic
984041972 4:174746184-174746206 TGTGATAAACGTACAAGTGCAGG - Intronic
984107905 4:175573212-175573234 TATGATAAACACACAAGTGCAGG + Intergenic
1202770851 4_GL000008v2_random:205570-205592 CAAGATAAAGATACAAATGCAGG + Intergenic
985596335 5:791449-791471 TGTGATAAACATACAAGTGCAGG - Intergenic
986277703 5:6293768-6293790 TATGATAAACATGCAAGTGCAGG + Intergenic
986931030 5:12821642-12821664 TATGATAAACATACAAGTGGAGG + Intergenic
987057768 5:14210961-14210983 CATGGCAAACTTACAAGGGCAGG - Intronic
987274093 5:16343912-16343934 CAGGGTACAAGTACAAGTGCAGG + Intergenic
987595227 5:19988747-19988769 CCTGCTAAACATTCAACTGCTGG + Intronic
987776704 5:22376001-22376023 CACAATAAACATGCAAGTGCAGG - Intronic
987821037 5:22967109-22967131 AATGGAAAACATAAAAGAGCAGG - Intergenic
988152248 5:27399444-27399466 TGTTATAAACATACAAGTGCAGG - Intergenic
988163330 5:27549999-27550021 AATGGGAAACATAAAAGAGCAGG - Intergenic
988820426 5:34878884-34878906 TACGATAAACATACAAGTGCAGG - Intronic
989237557 5:39166484-39166506 TGTGATAAACATACAAGTGCAGG - Intronic
990411505 5:55545745-55545767 CATGGCAAACACACAACTTCTGG + Intergenic
990641201 5:57785661-57785683 CATTGCAAACATACAAGGGGAGG - Intergenic
991147867 5:63328239-63328261 TGTGATAAACATACAAATGCAGG + Intergenic
992421769 5:76613310-76613332 CATGGTAAACTTACAAGCATTGG + Intronic
993564870 5:89461347-89461369 TGTCATAAACATACAAGTGCAGG - Intergenic
994046131 5:95312519-95312541 TGTGATAAACATATAAGTGCGGG - Intergenic
994337033 5:98579082-98579104 TGTGATAAACATATAAGTGCAGG + Intergenic
994942603 5:106344441-106344463 TATGATAAACATATGAGTGCCGG - Intergenic
995117524 5:108498726-108498748 TGTGATAAGCATACAAGTGCAGG + Intergenic
996165792 5:120221166-120221188 TGTGATAAACATAAAAGTGCAGG + Intergenic
996504046 5:124249280-124249302 TGTGATAAACATACATGTGCAGG - Intergenic
997045115 5:130306824-130306846 CATGATAAACATCCAAGTGCAGG - Intergenic
998891320 5:146749067-146749089 AATGGTAGCAATACAAGTGCTGG - Intronic
999025413 5:148225147-148225169 TGTGATAAACATATAAGTGCAGG + Intergenic
1000326192 5:160174357-160174379 CCTTGTAAACATACAAGAGATGG + Intergenic
1000696080 5:164386032-164386054 TGTGATAAACATACGAGTGCAGG - Intergenic
1001090100 5:168733480-168733502 TGTGATAGACATACAAGTGCAGG - Intronic
1003002674 6:2350626-2350648 TGTGATAAACATACAAGGGCAGG + Intergenic
1003080871 6:3020234-3020256 TGTGATGAACATACAAGTGCAGG + Intergenic
1003667605 6:8126325-8126347 TATGATAAACACACACGTGCAGG - Intergenic
1003936218 6:10977555-10977577 CTGGATAAACATACAAATGCAGG + Intronic
1003943276 6:11049575-11049597 TATGATGAACATACAAGTGCAGG + Intergenic
1004612258 6:17254088-17254110 TGTGATAAACATACAAGTGCAGG - Intergenic
1004853326 6:19723666-19723688 CATGGTAAAAATACATAAGCAGG - Intergenic
1005157739 6:22826509-22826531 CATGGTACGGATACAAGTCCTGG - Intergenic
1005159430 6:22841972-22841994 CATGATAAATATACAAATGCAGG - Intergenic
1005262269 6:24073656-24073678 CATGATAAACATATGTGTGCAGG + Intergenic
1005280934 6:24272900-24272922 TGTGATAAAAATACAAGTGCAGG - Intronic
1005685502 6:28249863-28249885 CATGGAAAACATAGAAATGTTGG - Intronic
1005779477 6:29174182-29174204 CATGATAAACGCAGAAGTGCTGG - Exonic
1005780113 6:29182062-29182084 AATGATAATCATAAAAGTGCCGG - Intergenic
1006035032 6:31204687-31204709 CTTGATTAACAAACAAGTGCTGG - Intergenic
1006967029 6:37998007-37998029 CATGATAAACATTCATATGCAGG - Intronic
1009178684 6:60490400-60490422 TGTGATAAACATAAAAGTGCAGG - Intergenic
1009308853 6:62124690-62124712 TATGATAAATACACAAGTGCAGG + Intronic
1009487945 6:64249090-64249112 TATGATAAACATATGAGTGCAGG - Intronic
1010063143 6:71647495-71647517 CATTATAAACATATGAGTGCAGG - Intergenic
1010072878 6:71764698-71764720 CATAGAAAACCTACAAATGCCGG + Intergenic
1010272601 6:73931220-73931242 TATGATGAACATACAAGTGCAGG + Intergenic
1010344651 6:74797777-74797799 CAAGGTAAGCATAAAAGGGCAGG + Intergenic
1010658938 6:78546215-78546237 TATGATAAACATATGAGTGCAGG - Intergenic
1011066499 6:83332447-83332469 TGTGATAAACATACATGTGCAGG - Intronic
1011294725 6:85814060-85814082 TGTGATAAACATACAGGTGCAGG + Intergenic
1011585017 6:88915308-88915330 TGTGGTAAACATACAAGTGCGGG - Intronic
1011716403 6:90109592-90109614 CATGTTGAATATACAAGTTCAGG - Intronic
1011866924 6:91840710-91840732 TGTGATAAACATACAAGTGCAGG + Intergenic
1012830540 6:104199223-104199245 TGTGATAAACATACATGTGCAGG - Intergenic
1013098113 6:106964399-106964421 CACAATGAACATACAAGTGCAGG + Intergenic
1013506148 6:110802223-110802245 TATGATAAATATACGAGTGCAGG - Intronic
1013580332 6:111527779-111527801 CATGGTAAACACACAATGGAGGG - Intergenic
1013661707 6:112304365-112304387 TCTGATAAACATACTAGTGCAGG + Intergenic
1014396862 6:120934433-120934455 TGTGATAAACATACAAGTGCAGG - Intergenic
1014413693 6:121157331-121157353 AATGGAAAACATAAAAGAGCAGG - Intronic
1015175456 6:130302619-130302641 TGAGATAAACATACAAGTGCAGG - Intronic
1015350051 6:132207920-132207942 CATGGAAAACAAAAAAGAGCAGG - Intergenic
1015779038 6:136844467-136844489 AATGGTAACCATTCAAGTGATGG - Intronic
1016633845 6:146264985-146265007 TCTGATAAACATACAATTGCAGG + Intronic
1016865615 6:148762953-148762975 TATGATAAACATACAAGGGCAGG + Intronic
1018327918 6:162693838-162693860 CATGTTAAATATGCATGTGCAGG - Intronic
1019033968 6:169039199-169039221 TGTGATAAACATACAAGGGCAGG - Intergenic
1019831865 7:3338342-3338364 CATTGTAAACAAACAAGGTCAGG + Intronic
1021437328 7:20634347-20634369 TACAATAAACATACAAGTGCAGG + Intronic
1021945647 7:25724310-25724332 CCTGGAAAACATACTAGTTCTGG - Intergenic
1023435708 7:40138445-40138467 CGTGATAAACATATGAGTGCAGG + Intronic
1024187237 7:46962812-46962834 TGTGATGAACATACAAGTGCAGG - Intergenic
1024592080 7:50896454-50896476 AATGGTAAACAAAAAAGAGCAGG + Intergenic
1025072000 7:55907909-55907931 TGTGATAAACATACAAGTGCAGG + Intronic
1025215841 7:57055453-57055475 TGCGATAAACATACAAGTGCAGG - Intergenic
1025655538 7:63515249-63515271 TGCGATAAACATACAAGTGCAGG + Intergenic
1026190352 7:68120101-68120123 TGTGATAAACATACAAGTGCAGG - Intergenic
1026192112 7:68138441-68138463 CATGATAAATATAGAAGTGCAGG - Intergenic
1026591696 7:71701622-71701644 TGTGATGAACATACAAGTGCAGG - Intronic
1027952361 7:84833730-84833752 CATGGTAAACACACTTCTGCTGG - Intergenic
1028431486 7:90751847-90751869 AATGGAAAACAAACAAGAGCAGG + Intronic
1030434417 7:109498256-109498278 CCTTGTAAACACACTAGTGCTGG + Intergenic
1030465578 7:109899309-109899331 CGTGATAAACATATGAGTGCAGG - Intergenic
1030927084 7:115471586-115471608 CCTGGAAAACATATAAGAGCTGG + Intergenic
1031683531 7:124704245-124704267 CGTGATAAACATGCAAATGCAGG + Intergenic
1032331168 7:130981510-130981532 TGTGATAAACATACGAGTGCAGG - Intergenic
1033833476 7:145281605-145281627 AATGGTAACCATAAAAGAGCAGG - Intergenic
1034205671 7:149312342-149312364 TGTGATAAACATACAAGTGAAGG + Intergenic
1034221485 7:149449882-149449904 CCCTGTAAAAATACAAGTGCTGG - Intronic
1035122490 7:156579872-156579894 CCTTGAAAACATTCAAGTGCAGG + Intergenic
1035902656 8:3474280-3474302 TATGATAATCATACAAATGCAGG + Intronic
1038309137 8:26432175-26432197 TGTGATAAACATACAAGTGCAGG + Intronic
1038708388 8:29918757-29918779 CATGATAAACATACTAGTACAGG - Intergenic
1039091005 8:33829620-33829642 TGTGATAAACATACAAGTGCAGG + Intergenic
1039231092 8:35449142-35449164 TGTGATAAACATACAAGTACAGG + Intronic
1039446094 8:37634115-37634137 TGTGATAAACACACAAGTGCAGG - Intergenic
1039786584 8:40839515-40839537 TGTAATAAACATACAAGTGCAGG - Intronic
1041207874 8:55516814-55516836 CACGATCAACATACAAGTGCAGG - Intronic
1041887080 8:62822666-62822688 CAAGGTACACATAACAGTGCAGG - Intronic
1042379648 8:68098090-68098112 CATGGTAAAGAGGCAACTGCTGG + Intronic
1042702708 8:71634289-71634311 TGTGATAAACACACAAGTGCAGG + Intergenic
1042943814 8:74134671-74134693 TATGATAAACATATGAGTGCAGG - Intergenic
1042988994 8:74617657-74617679 TGTGATAAGCATACAAGTGCAGG + Intronic
1043358773 8:79444945-79444967 CTTGATAAACATACATGTGCAGG + Intergenic
1044098549 8:88100669-88100691 CACAATAAACATACATGTGCAGG - Intronic
1044284953 8:90400330-90400352 TATGATAAGCATACAAGTGGAGG + Intergenic
1044452122 8:92348910-92348932 CATGATAAACATACCAGAGATGG + Intergenic
1044970081 8:97610932-97610954 TGTGATAAACATACAAGTGCAGG + Intergenic
1047515761 8:125553438-125553460 TATGATAAACATGCAGGTGCAGG + Intergenic
1047889107 8:129287723-129287745 CGTGATAAACATACATGTACAGG - Intergenic
1048088554 8:131212249-131212271 TATAATAAACATATAAGTGCTGG + Intergenic
1048515350 8:135103703-135103725 TGTGATAAACATACAACTGCAGG + Intergenic
1049114688 8:140675949-140675971 CATGATAAACATAGCAGTGCAGG - Intronic
1050045713 9:1542767-1542789 TGTGATAAACATACACGTGCAGG + Intergenic
1050400873 9:5252916-5252938 TACAATAAACATACAAGTGCAGG + Intergenic
1050732280 9:8722658-8722680 GATGGTCAACATAGAATTGCAGG - Intronic
1051135326 9:13913837-13913859 GCTGTCAAACATACAAGTGCAGG + Intergenic
1051197854 9:14583130-14583152 TATAGTAAACATGAAAGTGCAGG - Intergenic
1052588625 9:30462179-30462201 TATGCTAAACATGGAAGTGCAGG + Intergenic
1054355188 9:64054117-64054139 CAAGATAAAGATACAAATGCAGG - Intergenic
1055039594 9:71854997-71855019 CAGGGAAGAAATACAAGTGCTGG + Intergenic
1058665832 9:107314620-107314642 TGTGATTAACATACAAGTGCAGG + Intronic
1058682889 9:107455583-107455605 CATGATTTACATGCAAGTGCTGG + Intergenic
1058778691 9:108311226-108311248 CATGCAAGACCTACAAGTGCAGG + Intergenic
1058938272 9:109789509-109789531 CATGGTACAAAGACAAGTGAGGG - Intronic
1059217979 9:112584329-112584351 CATGGTAAACATACTCTAGCTGG + Intronic
1203743516 Un_GL000218v1:23222-23244 CAAGATAAAGATACAAATGCAGG - Intergenic
1203703798 Un_KI270742v1:18183-18205 CAAGATAAAGATACAAATGCAGG - Intergenic
1185931074 X:4204026-4204048 TATGATAAACACACAAGTGCAGG - Intergenic
1186073493 X:5850053-5850075 GAAGGTAAACCTACCAGTGCAGG - Intronic
1186135791 X:6519021-6519043 TATGATAAATATACAAGTGTAGG + Intergenic
1186326624 X:8484627-8484649 CATGTTAAAAATGCTAGTGCGGG - Intergenic
1187632687 X:21192351-21192373 TATGATAAACATACAAGTGCAGG - Intergenic
1187731177 X:22256372-22256394 CATGATAAAGCTACAAGTGCTGG - Intergenic
1188406263 X:29814040-29814062 TGTGATGAACATACAAGTGCAGG + Intronic
1188469860 X:30525988-30526010 CATGGTCCACATACCACTGCTGG - Intergenic
1188648975 X:32606600-32606622 TATGATAAACATACAACTGCAGG - Intronic
1188961496 X:36498182-36498204 TATGATAAACATACAAATGCAGG - Intergenic
1189237607 X:39499850-39499872 TGTGATAAACATACATGTGCAGG + Intergenic
1189665009 X:43344810-43344832 TGTGATGAACATACAAGTGCAGG + Intergenic
1189778972 X:44495738-44495760 CACAATGAACATACAAGTGCAGG + Intergenic
1191162993 X:57354129-57354151 CTGTATAAACATACAAGTGCAGG - Intronic
1191834377 X:65448437-65448459 TGTGATAAACATACACGTGCAGG - Intronic
1191836321 X:65467401-65467423 TGTGATAAACATACATGTGCAGG + Intronic
1191951079 X:66593892-66593914 CATGATAAATACACAAGTTCTGG + Intergenic
1192863582 X:75106683-75106705 TGTGGTAAACATATGAGTGCAGG - Intronic
1193649716 X:84115646-84115668 TGTGATAGACATACAAGTGCAGG - Intronic
1193863940 X:86705783-86705805 TGTGGTAAGCATACAAGCGCAGG - Intronic
1193874703 X:86848031-86848053 AGTGATAAACATACAAATGCAGG + Intergenic
1194021022 X:88692565-88692587 TACAATAAACATACAAGTGCAGG - Intergenic
1194695140 X:97038313-97038335 TGTGATAATCATACAAGTGCAGG + Intronic
1194896568 X:99448675-99448697 CGTGATAAACATATGAGTGCCGG - Intergenic
1195585953 X:106565840-106565862 CATGGTAAATATTCAAATGCAGG - Intergenic
1197078362 X:122379797-122379819 TACAATAAACATACAAGTGCAGG + Intergenic
1197511798 X:127378900-127378922 TGTGATAAACATAGAAGTGCAGG - Intergenic
1197580097 X:128271569-128271591 TGTGATAAACATACAAGTGCAGG - Intergenic
1199181281 X:144856732-144856754 TGTGATAAACATATAAGTGCAGG - Intergenic
1199364632 X:146966065-146966087 TATGATAAATATACGAGTGCAGG - Intergenic
1199368359 X:147015785-147015807 CACAATAAACATATAAGTGCAGG - Intergenic
1199422692 X:147662962-147662984 TGCGATAAACATACAAGTGCAGG + Intergenic
1200013282 X:153137706-153137728 TATAGTAAACATGCAAGAGCAGG + Intergenic
1200026320 X:153262217-153262239 TATAGTAAACATGCAAGAGCAGG - Intergenic
1200377290 X:155796558-155796580 TGTGATAAACATACAAGTACAGG + Intergenic
1201523140 Y:14899392-14899414 GAAGGTAAACCTACCAGTGCAGG + Intergenic