ID: 966325066

View in Genome Browser
Species Human (GRCh38)
Location 3:178744793-178744815
Sequence TGTGTAAGAAGAGCAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966325066_966325067 -3 Left 966325066 3:178744793-178744815 CCTGATTTTGCTCTTCTTACACA 0: 1
1: 0
2: 3
3: 21
4: 299
Right 966325067 3:178744813-178744835 ACAAGTTATCAGCCACTTCTAGG 0: 1
1: 0
2: 1
3: 7
4: 150
966325066_966325068 -2 Left 966325066 3:178744793-178744815 CCTGATTTTGCTCTTCTTACACA 0: 1
1: 0
2: 3
3: 21
4: 299
Right 966325068 3:178744814-178744836 CAAGTTATCAGCCACTTCTAGGG 0: 1
1: 0
2: 1
3: 13
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966325066 Original CRISPR TGTGTAAGAAGAGCAAAATC AGG (reversed) Intronic
900979912 1:6040495-6040517 TCTGGAAGAAAAGCAAAATAAGG - Intronic
900994085 1:6110925-6110947 CTTGTAAGAAGAGGAAAATTTGG + Intronic
901692786 1:10984458-10984480 TTTATAAGAAGAGGAAAATTGGG - Intergenic
902117379 1:14132564-14132586 TGTCTCCGAAGAACAAAATCAGG + Intergenic
902279007 1:15360832-15360854 TGTGTAACAAGAACAAAAGGGGG - Intronic
908287546 1:62623965-62623987 TGAGTAAGAAGAGGAAATCCTGG - Intronic
910792726 1:91067967-91067989 TGGGTAAGAAGAGCAAAACTCGG - Intergenic
910994322 1:93087861-93087883 TGTTTAACAAGTGAAAAATCTGG - Intronic
911147349 1:94565489-94565511 CCTGGAAGAAAAGCAAAATCAGG - Intergenic
911706987 1:101025639-101025661 TGTGTAACAAGAGGCAAAACTGG - Intronic
913150703 1:116039756-116039778 TCTGAAAGAAGAGAAAATTCAGG - Intronic
913572286 1:120132560-120132582 TGTGTAAGATTAGAAACATCTGG + Intergenic
914293207 1:146294204-146294226 TGTGTAAGATTAGAAACATCTGG + Intergenic
914554251 1:148744987-148745009 TGTGTAAGATTAGAAACATCTGG + Intergenic
914897190 1:151687202-151687224 TGTTCAACAAGGGCAAAATCAGG - Intronic
916167829 1:161979124-161979146 TGGGCAACAAGAGCAAAATTCGG - Intergenic
918704449 1:187642664-187642686 TGTGTAAGAACAGTAAAATGTGG + Intergenic
919068620 1:192725926-192725948 TATGTATGAAGAGAAAAAACAGG + Intergenic
919125837 1:193392392-193392414 TTTTTCAGAAGATCAAAATCTGG - Intergenic
919613067 1:199770755-199770777 TATTTGAGAAGAGCAAAAACAGG - Intergenic
921427657 1:215022760-215022782 TGGAAAAGAAGAGAAAAATCAGG - Intronic
921699831 1:218256059-218256081 TGTGAAATATGAGCAAAATCTGG + Intergenic
921958062 1:221004410-221004432 TGTTAAAGAAGAGAAGAATCTGG - Intergenic
923794454 1:237140611-237140633 TGTGTAAATAGAGTGAAATCAGG + Intronic
1062812394 10:476733-476755 TCTGTTACAAGAACAAAATCTGG + Intronic
1064253783 10:13727200-13727222 TGTGTTAGAAATGCAAACTCTGG - Intronic
1064546885 10:16459770-16459792 TGAGTAAGGAGAGCAAAACTTGG - Intronic
1068618979 10:59156623-59156645 TATGTAGGAAGAGAAAAATAGGG - Intergenic
1068622098 10:59197613-59197635 TGTTAAAGAAGAGTAAAAGCAGG - Intronic
1068767221 10:60777168-60777190 TGTATTAGAAGACCCAAATCAGG - Intergenic
1069688227 10:70333040-70333062 TGGGTAAGAAGAGCAGAGGCAGG + Intronic
1070255828 10:74812509-74812531 TGGGTAACAAGAGCAAAACTCGG + Intergenic
1072665218 10:97387915-97387937 TGTGCAACAAGAGCAAAACTCGG + Intronic
1073467448 10:103702499-103702521 TGTTTAAAAAGAGCAGAAGCAGG + Intronic
1073533300 10:104253006-104253028 TTAATAAGAAGAGCAAAGTCTGG + Intronic
1074432560 10:113406367-113406389 TTTATAAGAAGAGGAAAATTTGG + Intergenic
1074743446 10:116507357-116507379 TTTTTAAGAAGAGAAAAATATGG + Intergenic
1078572080 11:12467994-12468016 TGTGTAAAAATAGCAAGATGTGG - Intronic
1079582221 11:22079757-22079779 TCTGAATGAAGAGGAAAATCAGG + Intergenic
1080314344 11:30932919-30932941 TGTGAAAGAAGAGTAAATGCAGG + Intronic
1080373873 11:31684923-31684945 TGTTTAGTAAGATCAAAATCAGG - Intronic
1081060104 11:38463661-38463683 TGTGTTAGCAAAGCAAAATGTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1081402493 11:42659402-42659424 TATGCAAGATGAGCAAATTCTGG - Intergenic
1081740614 11:45437136-45437158 TTTCTAAGAAAAGAAAAATCTGG + Intergenic
1083355956 11:62066350-62066372 TTTGTAAGAAGAGAGAAATTTGG - Intergenic
1084269868 11:68023030-68023052 TGTGTAAGAAGGACAAAGGCAGG - Intronic
1086882049 11:92160877-92160899 AGAGGAAGAAGAGCAAAATATGG + Intergenic
1087015613 11:93551801-93551823 TGTGAAATAAGAGCCAAATTAGG + Intergenic
1088738765 11:112749726-112749748 TGTGTATCAAGTGCAGAATCTGG - Intergenic
1089778185 11:120853995-120854017 TGTGGTAGAAGAGCAAACTGAGG - Intronic
1091570643 12:1682523-1682545 TGGGCAAGAAGAGCGAAATGTGG + Intergenic
1091884356 12:4005033-4005055 TGTGCGAGAAGAGCAGAACCCGG - Intergenic
1093103071 12:15051303-15051325 TGTTTAAGAAGACAAAAATATGG + Intergenic
1094286298 12:28798311-28798333 TGTGTAAGAAATGCTAAATCTGG + Intergenic
1097141512 12:56906264-56906286 TGTATAGGAAGAGTAAAATGTGG + Intergenic
1098339368 12:69436072-69436094 TGTGTATGAAGTTCAAAAACAGG + Intergenic
1099117671 12:78647996-78648018 AGTGTGAGAAGAGGAATATCAGG - Intergenic
1099117902 12:78650077-78650099 AGTGTGAGAAGAGGAATATCAGG - Intergenic
1102162246 12:110778953-110778975 TATGTAAGAAGAGGAAAAGAGGG + Intergenic
1103654708 12:122461119-122461141 TTTATAAGAAGAGGGAAATCTGG - Intergenic
1103900639 12:124302081-124302103 TTTCTAAGAAGAGGGAAATCTGG - Intronic
1103920033 12:124394559-124394581 CTTGTAAGAAGAGGAAAATGTGG + Intronic
1105799409 13:23890322-23890344 CTTGTAAGAAGAGGAAAATTTGG + Intergenic
1105849638 13:24322716-24322738 CTTGTAAGAAGAGGAAAATTTGG - Intergenic
1106247124 13:27960212-27960234 TGTTTAAGAAAAACAAAATTGGG - Intergenic
1106380638 13:29235118-29235140 TGGGCAACAAGAGCAAAACCAGG - Intronic
1106624253 13:31404090-31404112 TGTGTAAGAACAGTAGAATATGG + Intergenic
1107659758 13:42626707-42626729 TGGGTAAGAAGAGCAGACTAGGG - Intergenic
1108126259 13:47246814-47246836 TGTGTAAAATGATCAAACTCTGG - Intergenic
1108385093 13:49892430-49892452 TGTGGAGGAAGAGCTGAATCAGG - Intergenic
1108590527 13:51908766-51908788 TGTGGAGGAAGAGCTGAATCAGG + Intergenic
1109127010 13:58530459-58530481 TGTGGAGGAAGAGCTGAATCAGG - Intergenic
1109513812 13:63414764-63414786 TGTGTGAGACCAGTAAAATCTGG + Intergenic
1110195692 13:72785431-72785453 TGTTTAATCAGAGCAAAATGGGG - Intronic
1110389304 13:74955754-74955776 TATGTAAGAAGAGAAAACCCAGG + Intergenic
1110414637 13:75238487-75238509 TGTGGAGGAAGAGCTGAATCAGG + Intergenic
1111001132 13:82184018-82184040 TCTGTAAAATGAGCAAAATCTGG + Intergenic
1112248987 13:97761293-97761315 TTGGTAAGAATAGCAAAATTGGG + Intergenic
1112381307 13:98893175-98893197 AGTGTAACCAGAGCGAAATCGGG + Intronic
1112685562 13:101821247-101821269 TTTTTAAAAAGAGCAAAATTTGG - Intronic
1113192355 13:107763583-107763605 TGTATAAGACAAGCAAAAGCAGG - Intronic
1113498703 13:110755662-110755684 TGTCTAGGAAGAGCAAAGACAGG - Intergenic
1114612054 14:24049236-24049258 TGTTTAAGAAGAGGAAAGTGAGG - Intergenic
1115353398 14:32421874-32421896 AGTGTATGAGGAGCCAAATCAGG + Intronic
1118054070 14:62060058-62060080 TTTTTAAGAAGAGCAAAGTAGGG - Intronic
1118591925 14:67408260-67408282 TGGGCAACAAGAGCAAAATTCGG + Intronic
1121225550 14:92319308-92319330 TGTGTAAGAGGGTCAAATTCTGG + Intergenic
1121690411 14:95874325-95874347 TGTTTAAGCATAGCAAAAGCTGG - Intergenic
1122017844 14:98811511-98811533 TGAGGAAGGAGAGCAACATCTGG - Intergenic
1124229607 15:27932399-27932421 TGAGGAATAGGAGCAAAATCTGG + Intronic
1125299793 15:38242673-38242695 AGTCTAAAAAGAGCAAAACCAGG + Intergenic
1125378955 15:39066313-39066335 TGTGTTAAAAGATCAAAATTGGG + Intergenic
1126151089 15:45524024-45524046 TGGGCAAGAAGAGCAAAACTCGG + Intergenic
1126257861 15:46649190-46649212 TGTGAAAGAAGAGAGAAAGCGGG - Intergenic
1126454026 15:48841718-48841740 TCTGTAAGAGGATCAATATCAGG - Intronic
1129320247 15:74770773-74770795 TGAGTAATAAGAGCAAAGTGAGG - Intergenic
1130301787 15:82685318-82685340 TTTGTAAAAAGTGCAATATCTGG + Intronic
1133133658 16:3694196-3694218 CGTATAAGAAGAGGGAAATCTGG - Intronic
1134452711 16:14373375-14373397 TGCTTAAAAGGAGCAAAATCTGG - Intergenic
1135207785 16:20497442-20497464 TTTGTAAGGAGAGTAAAATGTGG + Intergenic
1135211114 16:20526258-20526280 TTTGTAAGGAGAGTAAAATGTGG - Intergenic
1135845289 16:25913158-25913180 TTTATCAGAAGAGCAGAATCAGG - Intronic
1139751848 16:69113708-69113730 TGTGGAAGAAGAGCAAGAAAGGG - Intronic
1146987019 17:37229744-37229766 TGTGTAAGAAAAGCGAACTATGG + Intronic
1147047584 17:37765978-37766000 TGTGTAATAACAGCTATATCGGG + Intergenic
1147117311 17:38311120-38311142 TGTCTGAGATGAACAAAATCTGG - Intronic
1147532450 17:41292440-41292462 TGGGTGACAAGAGCAAAATTCGG + Intergenic
1147876451 17:43624349-43624371 TGGGCAACAAGAGCAAAATTCGG + Intergenic
1148412371 17:47478466-47478488 TGTCTGAGATGAACAAAATCTGG + Intergenic
1149342738 17:55703127-55703149 TGGGTAAGAAGAGAAGAATATGG + Intergenic
1150754727 17:67901048-67901070 TGTGTAAGAATAGCCAAAAGGGG + Intronic
1151588243 17:75024877-75024899 AGTGTAAGAAAAGCAAACACTGG + Intergenic
1152473316 17:80502404-80502426 TGTGGAGGAAGAGAAAATTCTGG + Intergenic
1154168496 18:12033995-12034017 TGTGTATGGAAAGTAAAATCTGG - Intergenic
1155266962 18:24103777-24103799 AGGGCAAGAAGAGCAAAAGCAGG - Intronic
1155538652 18:26843786-26843808 TGTGTAATAAAAGCAACATCTGG - Intergenic
1156530736 18:37812588-37812610 GGCGTAGGAAGAGCAAAGTCAGG - Intergenic
1156564411 18:38168814-38168836 TGAGTAAGAAGGGCCAAATATGG - Intergenic
1156773261 18:40756230-40756252 CTTGTAAGAAGAGGAAAATTTGG + Intergenic
1158887799 18:61845298-61845320 TGTGTAAGAAGAGCAATGCTAGG + Intronic
1158891137 18:61872673-61872695 TGTGGAAGAAGAGAATAATGAGG - Intronic
1159644023 18:70896484-70896506 TGTGGAAGTTGAGCAAGATCCGG - Intergenic
1165438776 19:35812114-35812136 TGTGTAAGGAGTGCAAAGACGGG - Exonic
1165754482 19:38284393-38284415 TGTCTCTAAAGAGCAAAATCTGG - Intronic
1166091770 19:40513847-40513869 TGGGTAACAAGAGCAAATGCTGG - Intronic
926726136 2:15999464-15999486 TGTGCAAAATGACCAAAATCTGG - Intergenic
927601234 2:24443417-24443439 TGCGTAACAAGAACAAAACCTGG - Intergenic
928223238 2:29422788-29422810 TCTGTAGGAAGAGTAAAACCTGG - Intronic
929366860 2:41169381-41169403 TATTTTAGAAGAGGAAAATCAGG + Intergenic
929971857 2:46586118-46586140 TCTGTTACAAGAGCAAATTCAGG + Intronic
930396085 2:50826337-50826359 TATGTAAGAAAAGCAAAGACAGG + Intronic
930904024 2:56544132-56544154 TTTGTAAGAAGAACAAAAAGAGG + Intergenic
931750785 2:65328020-65328042 TGGGTAAGAAAAGCAAAAATGGG - Intronic
932185340 2:69690568-69690590 TGTGTAGGAACTGCAAAAACAGG - Intronic
932916378 2:75863467-75863489 TGTGTAAGACAAACAACATCCGG - Intergenic
934158277 2:89223403-89223425 TATGTAAGAAGAGCACGAACTGG + Intergenic
934159561 2:89235318-89235340 TATGTAGGAAGAGCAAGAACTGG + Intergenic
934207717 2:89947113-89947135 TATGTAGGAAGAGCAAGAACTGG - Intergenic
934208989 2:89959021-89959043 TATGTAAGAAGAGCACGAACTGG - Intergenic
935829341 2:106984215-106984237 TGTGAAATATGAGCAAAATAAGG + Intergenic
937554575 2:123137804-123137826 TGTCCCAGAAGAGCAAAAACTGG + Intergenic
937710015 2:124969697-124969719 GGGGAAAGAAGAGCTAAATCAGG + Intergenic
939001891 2:136746155-136746177 TGTGTAGGAAGAGTGGAATCTGG + Intergenic
939327198 2:140708441-140708463 TGTGTATGAAGAGCACACACTGG + Intronic
939670883 2:145010631-145010653 TTTGTAAGAAAAAAAAAATCAGG - Intergenic
940486192 2:154298173-154298195 CATATAAGAAGAGGAAAATCAGG + Intronic
940875723 2:158895406-158895428 TGGGCAACAAGAGCAAAATTTGG - Intergenic
941115758 2:161470391-161470413 TGTGTGTGAGGAGGAAAATCAGG - Intronic
941249523 2:163145081-163145103 TGTGTAAGAACAGTAAAATGTGG + Intergenic
941615523 2:167714203-167714225 TGTGGAGGAAGAGCTGAATCAGG + Intergenic
942565155 2:177258789-177258811 TGAGTAAGAAAAGAAAAATATGG - Intronic
943419811 2:187655988-187656010 TGTGTAAGAAGAGCACAATGTGG + Intergenic
943491925 2:188564766-188564788 TGAGAGAGAAGACCAAAATCTGG + Intronic
943533451 2:189116451-189116473 TGTTTAAGGAAAGCAAAATGAGG - Intronic
943784742 2:191864882-191864904 GGGGTAAGAAGAGAAAAATGAGG - Intergenic
944236951 2:197449645-197449667 TGGGTAACAAGAGCAAAACGCGG - Intergenic
944244584 2:197518115-197518137 TGGGTAACAAGAGCAAAACTCGG + Intronic
944415171 2:199472725-199472747 ATTGTAATAAAAGCAAAATCTGG + Intergenic
944652879 2:201849338-201849360 AGTGAAAGAAGAGAACAATCGGG - Intronic
944687013 2:202126436-202126458 TCTGTAAGCAGAGAAATATCTGG + Intronic
945263730 2:207869667-207869689 GGTGGAAAAATAGCAAAATCTGG - Intronic
945464717 2:210155109-210155131 TGTGTAAGAAGACCTAAGTGAGG + Intronic
945777386 2:214123833-214123855 CGTGGAGGAATAGCAAAATCGGG + Intronic
947045102 2:225972934-225972956 CATGTAACAAGACCAAAATCTGG + Intergenic
1168937267 20:1676140-1676162 TCTGTAATAACTGCAAAATCAGG + Intergenic
1169883047 20:10368223-10368245 TGGGTAACGAGAGGAAAATCCGG - Intergenic
1170280112 20:14636833-14636855 TGGGGAAGAAGGTCAAAATCAGG + Intronic
1170828289 20:19816500-19816522 GGTGTCAGAAGATCAAATTCTGG + Intergenic
1170899984 20:20453274-20453296 TGTGTGAGAAGAACAAGACCAGG - Intronic
1171154245 20:22857810-22857832 TGTGAAAGAAGAGCAGTAACCGG + Intergenic
1171349620 20:24492584-24492606 AGTGTAAGAAGAGCAGCTTCAGG + Intronic
1172858924 20:38032351-38032373 AGTGCAATAAGAGCAAAAGCAGG + Intronic
1173512486 20:43641243-43641265 TGGGCAACAAGAGCAAAATTAGG - Intronic
1173748848 20:45459936-45459958 TGTATTAGAAAAACAAAATCTGG - Intergenic
1174879957 20:54268184-54268206 TTTGTAGGAAGGGCAAAATCTGG + Intergenic
1175291635 20:57879783-57879805 TGTGGGAGAAGAGAAACATCTGG - Intergenic
1178619934 21:34165465-34165487 TGTGTAAGAACAGTAAAATGTGG - Intergenic
1179365837 21:40758027-40758049 CTTATAAGAAGAGGAAAATCTGG + Intronic
1181925340 22:26354271-26354293 TTTGTAAGAAGAGGGAAATCTGG + Intronic
1182314876 22:29439042-29439064 TCTCTCAGAAGAACAAAATCAGG + Exonic
1185160561 22:49226156-49226178 TGAAAAAGAAGAGCAAAATTAGG + Intergenic
949271551 3:2223581-2223603 TCTGTAAGAATAGCATTATCAGG - Intronic
950497184 3:13340760-13340782 TGTGCTAGAAGAGCAACCTCTGG - Intronic
953532987 3:43754956-43754978 TGTGTAAGCAAGGCAAGATCAGG + Intergenic
953824421 3:46237901-46237923 GTGGTAAGAAGATCAAAATCAGG - Intronic
956888536 3:73586128-73586150 TTTTTAAAAAGAGCAAAATCAGG + Intronic
957831039 3:85519225-85519247 TGTCTAAGAAAGGCAAAAACGGG - Intronic
959665094 3:108911773-108911795 TGGGTAAAAAGAACAAAGTCAGG - Intronic
960485931 3:118253119-118253141 TGTGTAAGTAGTTCTAAATCAGG - Intergenic
963135968 3:141904678-141904700 TGTTTAAAAAGAATAAAATCAGG - Intronic
964687361 3:159411925-159411947 TGAAAGAGAAGAGCAAAATCAGG + Intronic
965349338 3:167594625-167594647 TGTGGTAGAAAAGCAAAACCCGG + Intronic
965422506 3:168479281-168479303 TGGGCAACAAGAGCAAAATTCGG + Intergenic
965725254 3:171709041-171709063 TCTCTAAGCAGAGAAAAATCAGG - Intronic
965802090 3:172504976-172504998 TTTGTAAGAAGAGGGAAATTTGG - Intergenic
966023819 3:175250143-175250165 TGGGCAACAAGAGCAAAATTCGG + Intronic
966169989 3:177069270-177069292 TGTATTAGAAGACCAAAATCAGG + Intronic
966325066 3:178744793-178744815 TGTGTAAGAAGAGCAAAATCAGG - Intronic
966344715 3:178965829-178965851 TGTGTGAGCAGAGCAATATAAGG + Intergenic
966379325 3:179327164-179327186 TGGGTAACAAGAGCAAAACTCGG + Intronic
966407282 3:179611141-179611163 TGTAGCAGAAGAGCAATATCAGG + Intronic
966494694 3:180566703-180566725 TAAGTAAGGAGAGCAAAATGGGG - Intergenic
967350903 3:188512533-188512555 TGGGCAACAAGAGCAAAACCCGG + Intronic
967457886 3:189710806-189710828 TGTGTAAGAAGAGCAGGAGGTGG - Intronic
967475751 3:189915414-189915436 TGTACAAGAAGAGAAAAATAGGG - Intergenic
970628500 4:17916165-17916187 TGTGTAAGAAAACAAAAATTAGG - Intronic
971573963 4:28250758-28250780 TGTGTAAGAAGAGCACAAGAGGG + Intergenic
971664946 4:29471153-29471175 TGTGTAAGATGAGCAGAATAAGG - Intergenic
971872021 4:32253393-32253415 TGTGTACAAAGATCTAAATCAGG - Intergenic
975614468 4:76233092-76233114 TGTGTAAGAACGGTAAAATGTGG - Intronic
976928920 4:90538245-90538267 TGAGTGAAAAGAGGAAAATCAGG - Intronic
978812501 4:112866288-112866310 TAGGTAAGAACATCAAAATCTGG + Intronic
979474018 4:121133794-121133816 TGTGTAAGAACAGGAAAATTTGG + Intronic
979861598 4:125700084-125700106 TGGGCAACAAGAGCAAAATTCGG - Intergenic
980722659 4:136717998-136718020 TGTGTAAGAACAGTAAAATATGG + Intergenic
980962579 4:139490925-139490947 TGTGGATGAAGAGCAAGATGTGG - Intergenic
981394577 4:144233081-144233103 TTTGTAAGAATAAAAAAATCAGG + Intergenic
982576541 4:157118053-157118075 TGTGGAAGAAGGACAAAATTTGG + Intronic
985256460 4:188075147-188075169 TGGGCAACAAGAGCAAAATTCGG - Intergenic
986085868 5:4445694-4445716 TGTGAAAGAAGAGAAAAATTGGG + Intergenic
986214847 5:5710080-5710102 TGTATATGAAGTTCAAAATCAGG + Intergenic
987240038 5:15987020-15987042 TATGCAAGAAGAGTAAATTCTGG - Intergenic
987873911 5:23655467-23655489 TTTATAAGAATAGAAAAATCAGG + Intergenic
988511321 5:31867066-31867088 GGTGTAACCAGAGCAAAATGAGG - Intronic
988540657 5:32105889-32105911 TGTGTAAAAAGTCCAAAAGCTGG + Intronic
988581324 5:32471475-32471497 TGTGTGGGAAGAGCAAAATTGGG - Intergenic
989745845 5:44828605-44828627 TGTGTATGAAAAGCAAAGGCAGG + Intergenic
990037545 5:51340301-51340323 AGTGAAAGAATAGAAAAATCTGG + Intergenic
992399038 5:76394820-76394842 TGGGAAATAAAAGCAAAATCTGG + Intergenic
993016164 5:82536801-82536823 TGTGTAAGAATTGCATATTCAGG + Intergenic
993647288 5:90476319-90476341 TGTGTAAAAAGGTCATAATCTGG + Intronic
994114640 5:96048660-96048682 TGTCTAAGAAAAAAAAAATCAGG - Intergenic
995364923 5:111347671-111347693 TTTATAAGAAGAGAGAAATCTGG - Intronic
999310977 5:150551985-150552007 TTTGTAAGAGGAGGAAAATGGGG + Intronic
999717247 5:154371222-154371244 TTTTTAAGAAGAGAGAAATCTGG - Intronic
1002156448 5:177284721-177284743 AGTGGAAGAAGAGCAACTTCAGG - Intronic
1002857540 6:1051531-1051553 TTTATAAGAAGAGGAAGATCTGG - Intergenic
1003178242 6:3769965-3769987 TGTGTCAGAAGAATGAAATCGGG - Intergenic
1004828357 6:19449302-19449324 TGTTTAAAAAGAACAAAAACGGG - Intergenic
1008191717 6:48466671-48466693 TGAGTAAGAAGAACAAAACTGGG + Intergenic
1008454064 6:51688309-51688331 TGTTTAAGAATAGCAAATTTTGG - Intronic
1009569626 6:65367341-65367363 TGTGAAAGAAAAACAAAATAAGG - Intronic
1013816337 6:114102762-114102784 TGTGTAAAAAGTTTAAAATCTGG + Intronic
1015260197 6:131228440-131228462 TGTGTAAGATAAGCACAATGAGG - Intronic
1015513844 6:134065535-134065557 AGTGAAAGAAGAGAAAATTCGGG + Intergenic
1016666739 6:146651057-146651079 TGTGTGAGGAAAGCAACATCTGG - Intronic
1016879204 6:148894380-148894402 TGTATAAGAAGAGGGAAATTTGG + Intronic
1017153820 6:151305063-151305085 TGTGTAAGAAAAGGATAAACGGG - Intronic
1018938137 6:168287454-168287476 TGTGGAGGAAGAGCTGAATCAGG + Intergenic
1019209511 6:170394044-170394066 TGTGTAAGATGAGCACACACGGG + Intronic
1021355108 7:19644613-19644635 TGTGGAAGAAGAGGATAAGCTGG + Intergenic
1023003875 7:35841248-35841270 TCTGTAACAAGAGCACTATCTGG + Intronic
1023269347 7:38444424-38444446 CCTGTAAGAAGAGGAAAATTTGG + Intronic
1025996499 7:66530615-66530637 TGGGTAAGAAGAGCTGAATCAGG + Intergenic
1026988557 7:74570016-74570038 TGGGTAAGAAGAGCTGAGTCAGG + Intronic
1027845499 7:83368784-83368806 AGAGTAAGAAGAGCAAGATAAGG + Intronic
1028269182 7:88767003-88767025 TGTTTAAGAAAAGAAAAAACTGG - Intronic
1029801592 7:102953523-102953545 TGTGTAAGAAAAGAAAAAAAAGG + Intronic
1030460158 7:109825469-109825491 TGGGTAAGAAGAAGAGAATCTGG + Intergenic
1030864270 7:114679579-114679601 TGTGTTAGAATAGCAGAATGAGG - Intronic
1031058083 7:117015922-117015944 TGTGTAAGTAGAGTTCAATCCGG - Intronic
1031186474 7:118487187-118487209 TTTGAAAGAAGAGGAAAAACTGG - Intergenic
1031373660 7:120997896-120997918 TGGGTAACAAGAGCAAAACTCGG + Intronic
1032146297 7:129384535-129384557 TGTGTATGAACAACAAAAGCAGG + Intronic
1032352220 7:131175289-131175311 TGTGGGAGAACAACAAAATCAGG - Intronic
1033050411 7:137999251-137999273 GGTGGAAGAAGAGCAAACTATGG - Intronic
1034568766 7:151937614-151937636 TTTGTAAGAAATGCAACATCTGG - Intergenic
1035417212 7:158699678-158699700 TGTGTAAGAGGAAGAAAATGAGG - Intronic
1037390725 8:18388866-18388888 TGTGGAAGAAGAGCAGAATTGGG - Intergenic
1037895600 8:22651704-22651726 TGTGTAAGAAAATAAAAAACAGG - Intronic
1038555404 8:28509532-28509554 TCTGGAAGAAGAGAAAACTCTGG - Intronic
1038660855 8:29495421-29495443 CTTGTAAGAAGAGGAAAATTTGG + Intergenic
1039354556 8:36800661-36800683 TGGGTTGGAGGAGCAAAATCTGG - Intronic
1040604766 8:48920897-48920919 TGTGAAAGATGAGCAACATAAGG - Intronic
1041099617 8:54382701-54382723 TGCAATAGAAGAGCAAAATCTGG + Intergenic
1041195100 8:55393858-55393880 TTTGAAAGAAGAGAAAATTCTGG - Intronic
1043055910 8:75438270-75438292 TGTATAAGAAGAGACAAATAGGG - Intronic
1044392788 8:91671565-91671587 TGACTAAGAAGATCAAAATGTGG - Intergenic
1045553979 8:103197317-103197339 TTTTTAAGAAGAGGAAACTCAGG - Intronic
1046190058 8:110782998-110783020 TTTGTAAGTAGAGTAAAATAGGG + Intergenic
1046504361 8:115117845-115117867 TGGGTGAGAAAAGCAAACTCAGG - Intergenic
1048675536 8:136774817-136774839 TGTGTAAAAGGAACACAATCAGG + Intergenic
1050535130 9:6624356-6624378 CTTATAAGAAGAGCAAAATTGGG + Intronic
1050578450 9:7025114-7025136 ACTGTAAGAAGAGAAAAATAAGG - Intronic
1051321430 9:15909474-15909496 TGTGTAAGAAGGACTATATCAGG - Intronic
1051441771 9:17091524-17091546 TGGGCAAGAAGAGCGAAATTCGG + Intergenic
1052034563 9:23665718-23665740 TGGGGAAGATGAGAAAAATCAGG + Intergenic
1052365609 9:27608932-27608954 TGTGGAGGAAGAGCTGAATCAGG + Intergenic
1052525246 9:29609145-29609167 TGTTTAAGAAGAAAAAAATAAGG + Intergenic
1055589684 9:77798919-77798941 TGTGTAATAACACCACAATCAGG + Intronic
1055809355 9:80134012-80134034 TGGGTAAGAAGAGTGAAATTCGG + Intergenic
1055908375 9:81319344-81319366 TGTCTAGGAAAAGCAAAATAGGG + Intergenic
1056835556 9:89952468-89952490 TGTCTAAGGAAAGCAAAATTTGG + Intergenic
1057064492 9:92036188-92036210 TGAGTGAGAAGAGAACAATCTGG - Intronic
1058019316 9:100070053-100070075 AGTTTTAGAAGAGCAAAATGTGG - Intronic
1058685303 9:107475023-107475045 TGTGCAAGAACAGAAAAATATGG + Intergenic
1060011120 9:120043495-120043517 GGTGTAAGAAGAGGAACATGAGG - Intergenic
1061843330 9:133373108-133373130 TGTGCCAGAAGAGCAACACCAGG + Intronic
1185771894 X:2771153-2771175 AGTGTAAGAAAAGCAGAAACTGG - Intronic
1185771910 X:2771234-2771256 AGTGTAAGAAAAGCAGAAACTGG - Intronic
1186301995 X:8210039-8210061 TGTGTATCAAGATCAAAATCTGG - Intergenic
1186384210 X:9092673-9092695 TATGTAAGAAGGGAAACATCCGG - Intronic
1187599180 X:20807652-20807674 TGAGTAGGAGGAGGAAAATCAGG - Intergenic
1191930635 X:66367524-66367546 TGTGAAGGAACAGCAAAACCAGG - Intergenic
1192348379 X:70332552-70332574 TGTGAAAAAAGAGAAAAATAGGG + Intronic
1192584486 X:72308456-72308478 TTTGTTAGAAGAGCAAATGCAGG - Intergenic
1193574296 X:83180530-83180552 TGTGTAAGAAGAGTAAAATGTGG - Intergenic
1194349892 X:92813253-92813275 TCTGTATGAACAGCAAAATTAGG + Intergenic
1194649184 X:96495485-96495507 TATTTAGGATGAGCAAAATCAGG + Intergenic
1194661869 X:96636828-96636850 TGTTTAAGAAGAGGAACAGCAGG + Intergenic
1195174101 X:102297995-102298017 TTTATAAGAAGAGGAAAATTGGG + Intergenic
1195184764 X:102389098-102389120 TTTATAAGAAGAGGAAAATTGGG - Intronic
1195362417 X:104096117-104096139 TATTTAAGCAGAGGAAAATCAGG + Intergenic
1195412234 X:104580017-104580039 TGTGGCAGAAGAGTAGAATCAGG - Intronic
1195790215 X:108576326-108576348 TGTTTAAGAAGAGCAAAAGCAGG + Intronic
1196162162 X:112497870-112497892 TGTGTAAGGAAAGCGAAATGTGG - Intergenic
1197366058 X:125566076-125566098 TATGTAAGAAAAGTAAAATGTGG - Intergenic
1198234923 X:134727813-134727835 TGTGTAAAAAGTCCAACATCAGG - Intronic
1199981274 X:152921831-152921853 CTTGTAAGAAGAGGGAAATCTGG - Intronic
1201792510 Y:17857769-17857791 TATGTAAGAAGAAAAAAATTGGG + Intergenic
1201809044 Y:18048217-18048239 TATGTAAGAAGAAAAAAATTGGG - Intergenic
1202354047 Y:24027014-24027036 TATGTAAGAAGAAAAAAATTGGG + Intergenic
1202516732 Y:25643098-25643120 TATGTAAGAAGAAAAAAATTGGG - Intergenic