ID: 966325733

View in Genome Browser
Species Human (GRCh38)
Location 3:178751668-178751690
Sequence CAAAGGTACAATAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966325733 Original CRISPR CAAAGGTACAATAGGGAAGA GGG Intronic
901181167 1:7342675-7342697 TAAGGGGAGAATAGGGAAGAAGG + Intronic
905038260 1:34930685-34930707 AAAAGGTAGAGGAGGGAAGAGGG - Intergenic
905953637 1:41974153-41974175 CAAAGGCACAAGAGAGAAAAGGG + Intronic
907487896 1:54789714-54789736 CAAAGACACAATAGAGTAGAAGG + Intronic
907585365 1:55612087-55612109 CCAGGGTAAAGTAGGGAAGAGGG - Intergenic
908362032 1:63378087-63378109 GAAAGATACAATATGTAAGAAGG - Intronic
908777351 1:67653379-67653401 CACAGTAACAAGAGGGAAGAAGG - Intergenic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
910019599 1:82570806-82570828 CAAAGGCACAAGTAGGAAGATGG - Intergenic
910581124 1:88826074-88826096 ATAAGGTAGAATAGTGAAGAAGG - Intronic
911341204 1:96640793-96640815 CAAAGTTACAATAGGGAATAAGG + Intergenic
911694890 1:100878967-100878989 TTTAGGTACAATAAGGAAGATGG - Intronic
911803451 1:102174712-102174734 TAAAAGAACAATAGAGAAGAAGG - Intergenic
912949383 1:114110325-114110347 CAAAAGTACACTAAGCAAGATGG + Intronic
913056353 1:115164866-115164888 CTTTGGTACAATATGGAAGAGGG + Intergenic
914995788 1:152542428-152542450 CCATGGAACATTAGGGAAGATGG - Intronic
915062648 1:153198977-153198999 CAGAGGACCAAAAGGGAAGAGGG + Intergenic
915541206 1:156567391-156567413 CAGAGGTGAAGTAGGGAAGATGG - Intronic
916478380 1:165192226-165192248 GAAAAGGAGAATAGGGAAGAGGG - Intergenic
918379694 1:183941483-183941505 CATGGGTAGACTAGGGAAGATGG - Intronic
919089928 1:192965778-192965800 CAAAGTTTCAATATGCAAGATGG + Intergenic
919592776 1:199525473-199525495 CAAAAGGAGAATATGGAAGAGGG + Intergenic
921591588 1:217010653-217010675 CAAAGGTACAAAATGAAAGATGG + Intronic
922529534 1:226333775-226333797 CAAAGGTTCCAAAGGGAAAATGG - Intergenic
922578453 1:226679270-226679292 CAAAAGCAGAAAAGGGAAGAGGG - Intronic
923012229 1:230097013-230097035 CAAAGCTACAACTGTGAAGAGGG + Intronic
923041668 1:230324048-230324070 CAAAGGTACATTCGGGAGCAGGG - Intronic
1063167510 10:3477178-3477200 CATGGGTAGAATAGGGCAGATGG + Intergenic
1064011536 10:11740368-11740390 CAGAGGTGCAATGGGGAAGATGG - Intergenic
1064835663 10:19526924-19526946 AAAATGTAGAATAGGAAAGAAGG + Intronic
1064871279 10:19939635-19939657 CAAAGGGAGAAAAAGGAAGAGGG - Intronic
1069454680 10:68544801-68544823 CAAAGGCACTAATGGGAAGAGGG + Intergenic
1070410059 10:76131242-76131264 CAAGGATACAATAGGAAAGTGGG - Intronic
1072902882 10:99425174-99425196 AAAAGGTAAACAAGGGAAGAAGG + Intronic
1073968508 10:109019500-109019522 AAAAGGTACAATTGTGAGGATGG - Intergenic
1074170550 10:110930851-110930873 AAAAGGCAGGATAGGGAAGAGGG - Intronic
1074978930 10:118603563-118603585 CAAAGGTGCACTAGCCAAGATGG - Intergenic
1075065352 10:119285576-119285598 CAAAGGCACAGCAGGGAAGATGG + Intronic
1076424469 10:130357627-130357649 CAAACTTAAAATAGGTAAGAAGG - Intergenic
1076570562 10:131429955-131429977 CAAAGGCACAAGAGGGCCGATGG + Intergenic
1077665110 11:4101229-4101251 TCAAGGTACAATAGGAAGGAAGG + Intronic
1080195063 11:29599700-29599722 CAAAGCTACAACAGTGTAGAAGG + Intergenic
1080698129 11:34620747-34620769 CAAAGACACCATCGGGAAGAGGG - Intergenic
1081556401 11:44166270-44166292 TAAAGGTTTCATAGGGAAGATGG + Intronic
1082777624 11:57259656-57259678 CAAAGGGAGAAGTGGGAAGAGGG - Intergenic
1083116977 11:60470572-60470594 CAAAGGGATAATCGGGGAGAAGG - Exonic
1083157815 11:60836117-60836139 AAGAGGTACAACAGGGAAGAGGG - Intergenic
1083583663 11:63840646-63840668 AAAAGGCACAGTAAGGAAGATGG - Intronic
1085420485 11:76354142-76354164 CTAAGGTAGAAGAGGGAAGCAGG + Intronic
1086276190 11:85132750-85132772 CAAAGGTAGGATAGGAAACAGGG - Intronic
1086999633 11:93401986-93402008 CAAAGGAAAAATAGGTAAGTGGG + Intronic
1087146970 11:94822123-94822145 CAAATGTAGAAGAGGGAACACGG + Intronic
1087417016 11:97870293-97870315 CTAAAGGACAATAGGGAGGAAGG - Intergenic
1087597251 11:100269917-100269939 CAAACATACAAAAGAGAAGAAGG - Intronic
1093220819 12:16418382-16418404 CGAAGGTAAAGCAGGGAAGATGG + Intronic
1093789697 12:23234324-23234346 CAAAGGTAGGATAGCGAACAAGG + Intergenic
1094279506 12:28720022-28720044 CAAAGGTCAAGTTGGGAAGATGG + Intergenic
1094407915 12:30138159-30138181 CAAAGGTACACTGGGGTGGAGGG + Intergenic
1094784831 12:33835786-33835808 CAAAGCTATAATAATGAAGAAGG + Intergenic
1095200010 12:39372909-39372931 GATAGGTGGAATAGGGAAGAGGG - Intronic
1095701329 12:45193961-45193983 CAAAGGTGCATTTGAGAAGAGGG + Intergenic
1096028372 12:48387961-48387983 CATAAGGACAATATGGAAGAGGG + Intergenic
1098302233 12:69066389-69066411 CATAGGAAGATTAGGGAAGAGGG + Intergenic
1099593535 12:84627057-84627079 CAAAGGTACAATAGAAATAATGG - Intergenic
1100176111 12:92032861-92032883 CAAAGGCACAAGATGGAAGAAGG - Intronic
1100699481 12:97131016-97131038 CAAAGGGAAAAAATGGAAGAGGG + Intergenic
1102769385 12:115460828-115460850 TAAAATTACAATAGGGAAAAAGG - Intergenic
1103762078 12:123257867-123257889 CAAAGGTACAATTTGAAATACGG - Exonic
1103859481 12:124000824-124000846 CAAAGGGTGAAAAGGGAAGAGGG - Intronic
1106920797 13:34561283-34561305 CCAAGGCAGAATAGGAAAGAGGG + Intergenic
1106998073 13:35510663-35510685 AGAAGGTAAAAGAGGGAAGAAGG + Intronic
1107363925 13:39649890-39649912 GAAAGGTACAAAATGGAAAATGG + Intergenic
1107385491 13:39904139-39904161 GAAAGGTAAAACAGGGAAGGGGG + Intergenic
1108293503 13:48987551-48987573 GAAAGGTTTAAAAGGGAAGAGGG - Intronic
1110971802 13:81772377-81772399 CAAAAGTACAATAGTTAAAATGG - Intergenic
1111237121 13:85423690-85423712 AAAAGGTATTATATGGAAGATGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1113507986 13:110830435-110830457 CAGAGGGACACCAGGGAAGAGGG + Intergenic
1113776288 13:112947537-112947559 AAAAGGAAAAATAGGCAAGAGGG + Intronic
1114810795 14:25896741-25896763 CAAAAGTACTATTGGGAAGTTGG - Intergenic
1117773790 14:59161796-59161818 CACAGGAACAAAAGGGAAAAGGG + Intergenic
1119252545 14:73169089-73169111 CAAAAGTAAAACAGTGAAGAGGG - Intronic
1120126182 14:80746344-80746366 CAAAGCTACAGTAGTCAAGATGG + Intronic
1120779244 14:88471330-88471352 AAAGGGTACAATGAGGAAGAGGG + Intronic
1120863488 14:89275857-89275879 CACAGCTAAAATAGGGAAAAAGG - Intronic
1124687447 15:31794490-31794512 CAAAGGTATAATATGGGGGAGGG + Intronic
1125175131 15:36812297-36812319 CAAAGATTAAATAAGGAAGATGG + Intergenic
1125388497 15:39165569-39165591 CAAAGTTATAATAGGCAACAGGG - Intergenic
1125795822 15:42403336-42403358 CAAAAATAAAGTAGGGAAGAGGG + Intronic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1126753213 15:51898401-51898423 AAAAGGCACAATAGGGTAGATGG - Intronic
1127515252 15:59687706-59687728 AGAAGGAACAATAGGGAGGAAGG - Intronic
1127537239 15:59901245-59901267 CTATGGGACAAAAGGGAAGAGGG - Intergenic
1127580644 15:60336337-60336359 AAAAGGTACAGCATGGAAGAGGG + Intergenic
1127891905 15:63259679-63259701 CAAATGTAGAAGAGGTAAGAAGG + Exonic
1128408852 15:67372438-67372460 CAAAGGTACAAGGGCCAAGATGG + Exonic
1132348682 15:101123780-101123802 CAGAGGGACAAAAGCGAAGATGG - Intergenic
1134072361 16:11268747-11268769 CAAAGGAACCACAGGCAAGAAGG - Intronic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135147989 16:19979733-19979755 GAAAGGGAGAAAAGGGAAGAGGG + Intergenic
1138362938 16:56447964-56447986 CAAAAGTATAATTGGTAAGAGGG + Exonic
1138522908 16:57581809-57581831 GAAAAGTACAATGTGGAAGAAGG + Intronic
1138954741 16:61957508-61957530 CTCAGGTACAAAAGAGAAGAGGG + Intronic
1139370915 16:66468964-66468986 CAAAGGCACAGAAGGGTAGAGGG - Intronic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1140320657 16:73948539-73948561 CAAAGCAACAATAAGGAAGGTGG - Intergenic
1143451741 17:7040850-7040872 CACAGGGATAATGGGGAAGAGGG - Intergenic
1145025136 17:19462620-19462642 CTAAGATACAATGGGGAAGTGGG - Intergenic
1145099214 17:20059627-20059649 CCAAGGTACAATGTGGAAAAGGG - Intronic
1146376149 17:32295893-32295915 CACAGGTAGTATAGGGAGGAAGG + Intronic
1146432926 17:32815569-32815591 CAAATCTACGAGAGGGAAGAGGG - Intronic
1147022380 17:37546922-37546944 CAAAGATAGAATAGGGACTAAGG - Intronic
1148317852 17:46719619-46719641 CAAACGTAAAATAGGGGAGAAGG - Intronic
1148740146 17:49888082-49888104 CAGAGGTAGGATAGGGAACAGGG - Intergenic
1149272824 17:55000193-55000215 CTAAGGAACAAAAAGGAAGATGG - Intronic
1149418224 17:56482730-56482752 CAAAGGCCCAATGGAGAAGAAGG + Intronic
1149518756 17:57302488-57302510 CAAAAATACACTTGGGAAGAAGG - Intronic
1149555189 17:57568618-57568640 AAAAGAATCAATAGGGAAGAAGG - Intronic
1151685812 17:75646084-75646106 CACTGGCACAATAGGGAAGCTGG - Intronic
1151826197 17:76525866-76525888 CAAGGGTACAATAGAGATGAAGG - Intergenic
1153156441 18:2154898-2154920 AAAATGTACATTATGGAAGATGG - Intergenic
1154134086 18:11760896-11760918 CAATGGTACAGTAGAGATGATGG + Intronic
1156882468 18:42096964-42096986 CAAAGCTACAGTAGTCAAGATGG + Intergenic
1157643335 18:49241036-49241058 CAAGGGTACAATAGCAAAGTTGG - Intronic
1157992242 18:52510927-52510949 AAAAGCTAGAAGAGGGAAGAGGG + Intronic
1164322149 19:24158944-24158966 GAAAGGGAGAATAGGGAAGAAGG - Intergenic
1166304853 19:41931885-41931907 CACAGGAACAAAAGGGAAGGTGG + Intergenic
926650546 2:15339332-15339354 TCATGGTACAGTAGGGAAGAAGG + Intronic
926828229 2:16931287-16931309 CAAGGGAAGAATAGGGGAGAAGG - Intergenic
927572684 2:24174180-24174202 CAACAGTAGAATAGAGAAGATGG + Intronic
927717090 2:25359951-25359973 CAAGGGAACAATGGGGGAGATGG + Intergenic
929585723 2:43113078-43113100 GAAAGGTACAGGAGGAAAGAGGG + Intergenic
930288109 2:49459473-49459495 GAAAGGAAGAAGAGGGAAGAAGG + Intergenic
930484469 2:51995039-51995061 CAAAGGTACAGAAGAGAATAAGG + Intergenic
930899045 2:56481452-56481474 AAAAGGTACCATAGGCAAGAGGG - Intergenic
931374576 2:61695765-61695787 CAAAGGTAGAATAGGTGAGGGGG + Intergenic
931787497 2:65633325-65633347 CAAAGTTACAATTAGAAAGATGG - Intergenic
933835661 2:86243377-86243399 CAAGGGTCCAAGAGGAAAGAGGG - Intronic
934701795 2:96447837-96447859 CACAGGTACAAAAAGGAAGAAGG - Intergenic
935634694 2:105241574-105241596 CAAAAGTACAAAAGAGAAGGGGG - Intergenic
937629591 2:124085544-124085566 CAAAGGTAGCAGAAGGAAGAGGG - Intronic
937763190 2:125629847-125629869 AAATTGTACAATAGGCAAGAAGG + Intergenic
938576872 2:132612712-132612734 TAAAGTTACAATAATGAAGATGG - Intronic
938821530 2:134965226-134965248 CAAAAGTACAATGGGAAAGTAGG - Intronic
939862634 2:147437942-147437964 GAAATGTACAATATGGTAGATGG - Intergenic
939904592 2:147896175-147896197 CAAAGTTATAAGTGGGAAGACGG + Intronic
941402957 2:165054198-165054220 AAATGGTACAATATAGAAGATGG + Intergenic
941690167 2:168493171-168493193 TAAAAGTACAATAAGGAAAATGG - Intronic
942609014 2:177722425-177722447 CAAACATACAATTGGGCAGAAGG - Intronic
942776697 2:179590397-179590419 CACAGGTAAAATAGGCAAAATGG - Intronic
943067014 2:183099001-183099023 TCAAGGTTCAATAGGGAAGAAGG - Exonic
945146886 2:206747792-206747814 CACTGAAACAATAGGGAAGATGG + Intronic
945635194 2:212340320-212340342 CACAGACAGAATAGGGAAGATGG + Intronic
947390601 2:229635412-229635434 CAAGGGTACAAAGAGGAAGAGGG + Intronic
947631006 2:231652954-231652976 CAAAGGTGGAACAGGGCAGAGGG - Intergenic
1168964365 20:1890394-1890416 TGAAGATAAAATAGGGAAGAGGG + Intergenic
1170453886 20:16514213-16514235 CAAAGGCACAGTAGGAAAGGAGG + Intronic
1171277526 20:23870629-23870651 CCAAGGAACAATGGAGAAGATGG - Intergenic
1171282463 20:23912260-23912282 CAAAGGAACAATGGAGAAGATGG - Intergenic
1171840269 20:30201910-30201932 AAAAGGTACAAAAGGAAACAGGG - Intergenic
1172242054 20:33419659-33419681 CAAAGGAAAAAGAGGGGAGATGG - Intronic
1172554893 20:35832264-35832286 CAGAGGTGCAAAAGGGGAGAGGG - Intronic
1173241046 20:41297515-41297537 CCATGGCACAATAGGAAAGATGG - Intronic
1173371725 20:42442358-42442380 AAAAGGTACAATAGGTCAGAGGG - Intronic
1176998523 21:15583456-15583478 CAAGGGTACAAAATAGAAGAAGG - Intergenic
1179010904 21:37555361-37555383 CAAAGGTTAAGCAGGGAAGAGGG - Intergenic
1181097881 22:20518459-20518481 CAAAGCTTCACCAGGGAAGAGGG - Intronic
950705122 3:14774739-14774761 CAAATGTACCTTAGGGAGGAGGG + Intergenic
951007802 3:17638585-17638607 AAAAGTTACAAAAGTGAAGATGG - Intronic
951047578 3:18057692-18057714 CAAATGGGCAACAGGGAAGATGG + Intronic
951593400 3:24291055-24291077 GAAAGGTACATTAAGGAAAATGG - Intronic
952174287 3:30844474-30844496 CAAAGGGACAGTGGGGAAGGGGG + Intronic
952702441 3:36341314-36341336 AATAGGAACAAAAGGGAAGAAGG - Intergenic
953565532 3:44028834-44028856 CAAAGGTACAATAGAGAAGACGG - Intergenic
953693040 3:45135860-45135882 GAAAGGCAACATAGGGAAGAGGG + Intronic
956291802 3:67668487-67668509 CAAAAGGACAATAGTGCAGAGGG - Intergenic
956581161 3:70815324-70815346 CATAGGAACAAGATGGAAGAAGG + Intergenic
956694994 3:71910885-71910907 CAAAGCTACAATAACCAAGAGGG + Intergenic
957641399 3:82858243-82858265 AAAGGGAACACTAGGGAAGAAGG + Intergenic
960143925 3:114178845-114178867 CTAAGGTCTAATAGGGAAGCTGG - Exonic
964577288 3:158186795-158186817 TAAAGGTAGAATTGGGAAGAAGG - Intronic
965222872 3:165950711-165950733 AAAAGGTATAATAGTGAAGCAGG - Intergenic
966325733 3:178751668-178751690 CAAAGGTACAATAGGGAAGAGGG + Intronic
966598041 3:181745076-181745098 AAAAGGAAGGATAGGGAAGAGGG - Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968814398 4:2814476-2814498 CACATGCACATTAGGGAAGACGG - Intronic
970074138 4:12198286-12198308 AAAAGGAAAAATAGGAAAGAAGG - Intergenic
970164409 4:13221364-13221386 CAAATGTAAAAGAGGGAAGAGGG + Intergenic
970486035 4:16525772-16525794 AAAAGGTAACGTAGGGAAGAGGG + Intronic
970824232 4:20253353-20253375 CGAAGGTACAAGACAGAAGAGGG - Intronic
973635181 4:52855582-52855604 AAAAGGTAAAGTAGGAAAGAAGG - Intergenic
974699886 4:65427618-65427640 CAAAGGTGGAAAAGGGAAGAGGG + Intronic
978337732 4:107687903-107687925 CAGAGGGACCATAAGGAAGATGG - Intronic
979571425 4:122230765-122230787 TAAATATACAATGGGGAAGATGG - Intronic
981043275 4:140242859-140242881 GAAAGGAAGAATGGGGAAGAAGG + Intergenic
981064257 4:140464544-140464566 CAAAGGTATAATAATGAGGAGGG - Intronic
981773603 4:148338648-148338670 CAAAGGAGCAATAGGGAATGGGG + Intronic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
983709315 4:170694405-170694427 CAAAGGCAGAAAAGGGAAAAAGG + Intergenic
984659252 4:182355496-182355518 CAGAGGTACAACAGTGAACAGGG - Intronic
986377409 5:7146624-7146646 CAAATGTAAAATAGGAGAGAAGG - Intergenic
988947974 5:36225754-36225776 CAAAGGTATAATAGGTAGAAAGG - Intronic
989269065 5:39510648-39510670 CAAAGGTACTGTAGGTCAGATGG + Intergenic
990640449 5:57778129-57778151 CAATGGTACAAAAGAGAAAATGG + Intergenic
993564700 5:89458558-89458580 CAAAAGTAGAATAGGGAAAAGGG + Intergenic
993579785 5:89645923-89645945 CAAATGTAAAATAGTCAAGATGG + Intergenic
995165351 5:109033514-109033536 CAAAAGTAAATTAGGGAACATGG - Intronic
997525172 5:134548382-134548404 CAACTGTAAAATAGGGATGATGG + Intronic
998506948 5:142679708-142679730 CCAAGGCCCAAGAGGGAAGAAGG - Intronic
999940937 5:156542196-156542218 AACAGGTGCAATTGGGAAGATGG + Intronic
999988384 5:157026274-157026296 GAAAGGGAGAATAGGTAAGAAGG - Intergenic
1000404179 5:160869018-160869040 CAAAGGTCAAATAGCCAAGATGG - Intergenic
1000503444 5:162082163-162082185 GAAAGTAATAATAGGGAAGATGG + Intronic
1000837771 5:166177388-166177410 AATAGGTACAAAAGGAAAGAAGG - Intergenic
1001448763 5:171807845-171807867 AAATGCTAAAATAGGGAAGAGGG + Intergenic
1001773679 5:174313300-174313322 GACAGGTACAAAAGGAAAGACGG - Intergenic
1004551305 6:16650603-16650625 CAAACTTAAAATATGGAAGAAGG - Intronic
1005277203 6:24231654-24231676 CAAAGGGAAAATGGTGAAGAGGG + Intronic
1006284641 6:33083202-33083224 CAAAAATACAATAGGGAGTAAGG + Intronic
1009304312 6:62068881-62068903 CAAAGCTACAATATTCAAGATGG - Intronic
1010009213 6:71030837-71030859 CAAAGGAAAATTAGAGAAGATGG - Intergenic
1010071153 6:71747712-71747734 CACAGGCAGAATAGGAAAGATGG - Intergenic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1012060583 6:94474414-94474436 CAAAGTTACAATTAGGTAGAAGG - Intergenic
1012197128 6:96357379-96357401 GAAAGGTACAATTAGGAATAAGG - Intergenic
1012346581 6:98195094-98195116 GAAAGGTAGAATTGGGAAAAAGG - Intergenic
1013239174 6:108227452-108227474 CAAAAGTTCAAAAGGGAAAATGG - Intronic
1013339202 6:109196687-109196709 CATAGGTAGAACAGGCAAGAAGG - Intergenic
1013760198 6:113509537-113509559 TAAAGGGAGAATAGGAAAGAAGG + Intergenic
1014627155 6:123740598-123740620 CAGGGGTACAACAGGGAATAGGG - Intergenic
1014918226 6:127180280-127180302 CAAAGGCAAATTAGGGAAGGAGG + Intronic
1015004343 6:128260406-128260428 CAAAAATAAAATAGAGAAGATGG + Intronic
1016045665 6:139477927-139477949 GCAAGGTAAAAGAGGGAAGAAGG + Intergenic
1016842433 6:148537982-148538004 CCAAGGTACAAAAGGTAAGAAGG - Intronic
1016938847 6:149468303-149468325 CAAAGGTACAAAGAGGAAGTGGG + Intronic
1018004462 6:159608595-159608617 CAAAGGTAGTATAGGGAACAGGG + Intergenic
1018805253 6:167254356-167254378 AAAAGAAACAATAGGAAAGAAGG + Intergenic
1021590998 7:22261786-22261808 CAAAGGTGCAAAAGGAAAGATGG + Intronic
1022730454 7:33018336-33018358 GAAGGGTAAAAAAGGGAAGAGGG - Intronic
1023963980 7:44952132-44952154 AAAGGGTGCAATAGGAAAGAAGG + Intergenic
1024840430 7:53579347-53579369 CAAAGCTACAAAAGAGAAAAAGG + Intergenic
1025907410 7:65798481-65798503 CAAAAGTATGTTAGGGAAGATGG + Intergenic
1026586905 7:71663087-71663109 CAAAGCTACTATAGTCAAGATGG - Intronic
1027455227 7:78382703-78382725 CAAAAGTACAATAAGATAGAAGG - Intronic
1029982858 7:104895540-104895562 CAGAGGTGCAACAGGGAAAAGGG + Intronic
1030155356 7:106449147-106449169 CAAACGTAAAATATGTAAGAAGG + Intergenic
1030296182 7:107930218-107930240 CAAATGTAAAATGTGGAAGATGG + Intronic
1031546116 7:123053173-123053195 CAAAGGTAGAATAAAGAAGCAGG - Intergenic
1034919523 7:155068505-155068527 CAGAGGTACCATATGGCAGACGG + Exonic
1035407877 7:158611814-158611836 CAAAGGTACAGGGGGGAGGAGGG + Intergenic
1035495991 7:159326607-159326629 CAAAGGGAAAAGGGGGAAGACGG - Intergenic
1037288290 8:17324018-17324040 CAAAGGGACAAAAGAAAAGAAGG - Intronic
1040302380 8:46194770-46194792 AAAAGACACAATAGGGAAGCAGG + Intergenic
1041113439 8:54509350-54509372 CAAAGAAATACTAGGGAAGAAGG - Intergenic
1045082134 8:98638388-98638410 CAAAGATACAGTAATGAAGATGG + Intronic
1045985058 8:108240266-108240288 CAAAGGCACAAAAAGGAAAAGGG + Intronic
1048748103 8:137637965-137637987 CAAAGGGAGAAAAGTGAAGATGG - Intergenic
1049140816 8:140952290-140952312 GAAAGGTACAATATGGACGGGGG + Intronic
1050993096 9:12176266-12176288 CAAAGGTAAGATACTGAAGACGG - Intergenic
1051624629 9:19087213-19087235 CAAAGGGAAAATAGAGAAGTGGG - Intronic
1053263378 9:36691530-36691552 CAAAGCTACAATAATCAAGATGG + Intergenic
1055293963 9:74815015-74815037 CAAAGGAAAGATAGGGAACATGG + Intronic
1055946275 9:81694157-81694179 CAAAGGGAGATTAGGGAATAGGG - Intergenic
1056898539 9:90575758-90575780 AAAGGGTACAATATGGAAAATGG + Intergenic
1058031202 9:100199676-100199698 CATAGGAACAACAGGGATGATGG - Intronic
1059125547 9:111681150-111681172 AAAAAGTACAATATGGAAAAGGG + Intergenic
1060150569 9:121285750-121285772 CAAAGGTAAATTAGGGAGGTGGG - Intronic
1061847930 9:133398302-133398324 CATAGGGACAGTGGGGAAGATGG - Intronic
1187310748 X:18139154-18139176 CAAAGATACAAGGGGTAAGAGGG + Intergenic
1188345355 X:29057924-29057946 CAAAGCTTAAATAGGGAACAGGG - Intronic
1192289288 X:69775322-69775344 CATAGGTACAGAAGGGAAGGTGG - Intronic
1193219066 X:78900614-78900636 TAAGGGTAGAGTAGGGAAGATGG + Intergenic
1193888872 X:87017755-87017777 CAAAGGTACAGTAGGGAAATAGG - Intergenic
1195678794 X:107528071-107528093 CAAAGGTATAACAATGAAGAAGG + Intronic
1198641623 X:138762251-138762273 CAAAGGCACCATTGGGAAGTTGG - Intronic
1199908249 X:152257780-152257802 CAAAAGTTCAAAAAGGAAGAGGG + Intronic
1202239749 Y:22754351-22754373 CTAAAGCACACTAGGGAAGAAGG + Intergenic
1202392735 Y:24388113-24388135 CTAAAGCACACTAGGGAAGAAGG + Intergenic
1202478048 Y:25282004-25282026 CTAAAGCACACTAGGGAAGAAGG - Intergenic