ID: 966327060

View in Genome Browser
Species Human (GRCh38)
Location 3:178768680-178768702
Sequence GAAATGGGCAGAGCTCCTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966327060_966327064 9 Left 966327060 3:178768680-178768702 CCTAAAGGAGCTCTGCCCATTTC 0: 1
1: 0
2: 2
3: 17
4: 178
Right 966327064 3:178768712-178768734 GCAACGTGCATTTACTTCTCAGG 0: 1
1: 0
2: 0
3: 3
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966327060 Original CRISPR GAAATGGGCAGAGCTCCTTT AGG (reversed) Intronic
900974551 1:6008918-6008940 GGAATGGGCAGGGCTGCTCTGGG - Intronic
901571103 1:10161338-10161360 CACACGGGCAGAGCTGCTTTGGG + Intronic
901811839 1:11771800-11771822 AAAATGGGCACAGTTCCTCTTGG - Intronic
904973161 1:34434889-34434911 GAGGTGGGCAGAGCTCAATTGGG - Intergenic
905054212 1:35079278-35079300 GAATTGGGAAGAGCGACTTTGGG - Intronic
905682513 1:39884265-39884287 GAACTGGGCAGACCTCATTCTGG - Intergenic
907192200 1:52658817-52658839 GAAATGTCAAGAGCTGCTTTTGG - Intronic
907401442 1:54227252-54227274 GAACTGAGCAGGGCTCATTTGGG + Intronic
911586164 1:99693566-99693588 CCAAAGGCCAGAGCTCCTTTGGG + Intronic
912360266 1:109089409-109089431 GAAAGGGGCAGAGTCCCTTTAGG + Intergenic
913198326 1:116476019-116476041 GAAGTGGGCAGTGCTGCTTAAGG - Intergenic
913510062 1:119553294-119553316 GAAATCGGCAGAGCTACTTCAGG + Intergenic
915716604 1:157950334-157950356 GAAAAGGGAAGAGCTCCATGAGG + Intergenic
916003330 1:160636926-160636948 GAAAGGGGCACAGCTCCTTGTGG - Intronic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
918054293 1:181005399-181005421 GAGATGGACAGAGCTCCTCCAGG - Exonic
919811635 1:201412452-201412474 GAGAAGGACAGGGCTCCTTTGGG - Intronic
922029112 1:221781087-221781109 GAAATGGACACAGGCCCTTTTGG - Intergenic
923188027 1:231593038-231593060 AAATTTGGCAGAGCACCTTTAGG + Intronic
923313539 1:232758097-232758119 GAAATGGGCAGAGTGCCATATGG - Intergenic
923492582 1:234497564-234497586 GAAAGGTGCAGAGCCCCTATAGG + Intergenic
1064668486 10:17683296-17683318 GAAATGGTCCCAGCTCCTATGGG - Intronic
1067170203 10:43899657-43899679 GCAATGGGCAAAACTGCTTTGGG + Intergenic
1072437554 10:95427905-95427927 GAAATGACCAGGGCTCCTTGTGG - Intronic
1072994811 10:100233434-100233456 GAAATTTGCATACCTCCTTTGGG - Intronic
1074703714 10:116113626-116113648 GAAATGGGCAGTGCGGCATTCGG + Intronic
1075393925 10:122113317-122113339 GAAGTGGCCAAAGCTCATTTCGG + Intronic
1075594263 10:123716629-123716651 GAAATGGGAAGAGCTCTTTCAGG - Intronic
1078600286 11:12724606-12724628 GAAATGGACAGAACCCCTTTGGG + Intronic
1078656304 11:13243798-13243820 AAAAAGGACAGAGCACCTTTGGG - Intergenic
1079496122 11:21046646-21046668 TAAATGGGCAAAGCTGCATTTGG - Intronic
1080688013 11:34531747-34531769 GAAATAGTCAGAGCTCATCTAGG + Intergenic
1081340409 11:41920635-41920657 GAAGTGAGCAGAGCTCCTAAAGG + Intergenic
1081823820 11:46026672-46026694 CATATGAGCAGAGCTCCTGTGGG + Intronic
1082828566 11:57598421-57598443 GGAATGAGGAGAGCTCCTCTTGG + Intronic
1084752426 11:71213049-71213071 GAAATGGGCACAGTGTCTTTCGG - Intronic
1085640142 11:78188369-78188391 GAAGTGGGCAGAGCTCTTAGAGG - Intronic
1088400676 11:109420506-109420528 GAAATAGCCAGATCTCTTTTTGG + Intergenic
1089634630 11:119804303-119804325 GAGATGCCCAGACCTCCTTTTGG - Intergenic
1089810148 11:121125111-121125133 GAAATGGAGAGAGCTGCTTGTGG - Intronic
1090571052 11:128046267-128046289 GAAAATTGCAGAACTCCTTTGGG + Intergenic
1093794402 12:23293889-23293911 GAAATGGGCAGAGATTCAATGGG + Intergenic
1099298529 12:80861695-80861717 GTTATGAGCAGAGCTCCTCTGGG - Intronic
1101507736 12:105362406-105362428 AAAATTTGGAGAGCTCCTTTGGG + Intronic
1102435777 12:112922162-112922184 TAAATGGCCATAGGTCCTTTGGG + Intronic
1103119645 12:118371224-118371246 GAAAGGGACAGGGATCCTTTTGG - Intronic
1106717299 13:32404867-32404889 ATAATGGGGAGAGCTACTTTTGG - Intronic
1107873309 13:44766332-44766354 GAAATGGACAGGTCTCCATTTGG + Intergenic
1109781586 13:67117361-67117383 GAAGTTGGCAGAGATCCTTAAGG - Intronic
1112755287 13:102625490-102625512 GAAAAGGGTACAGCCCCTTTAGG - Intronic
1113625186 13:111789686-111789708 GAGATGGGCAGAGATCAGTTAGG - Intergenic
1114559763 14:23581061-23581083 GCAGGGGGCAGAGCTCCTTGGGG - Intergenic
1115874692 14:37847152-37847174 GAAATGGGCACAGCAACTGTAGG - Intronic
1115933231 14:38521733-38521755 TAAATGGCCATAGTTCCTTTTGG - Intergenic
1116214626 14:41996772-41996794 GTGATGGGCAGAGCTCATTAAGG - Intergenic
1116429851 14:44833703-44833725 GAAAAGGGCAAGGTTCCTTTTGG - Intergenic
1117690443 14:58299481-58299503 GAAAAGGCCAGAGCTCCCTTCGG - Intronic
1118467182 14:66041667-66041689 GTAAAGGGCAGAGCAGCTTTGGG + Intergenic
1119975041 14:79015924-79015946 GAAAAGAGCAGAGGGCCTTTAGG - Intronic
1121567267 14:94919370-94919392 GATGGGGGCAGAGCTTCTTTGGG + Intergenic
1124717968 15:32084480-32084502 GCAAAGAGCAGAGCCCCTTTAGG + Intronic
1125205717 15:37151736-37151758 TAAATGTACAGAGGTCCTTTGGG - Intergenic
1125526625 15:40380291-40380313 GAAGTGTGCAGAGAGCCTTTGGG - Intergenic
1126129910 15:45330459-45330481 GAAAGAGGCAGAGCTTCTATTGG - Intergenic
1126222010 15:46224920-46224942 GACACAGGCAGAGCTGCTTTGGG + Intergenic
1126675182 15:51154884-51154906 TATGTGGGCACAGCTCCTTTTGG + Intergenic
1127333425 15:57960802-57960824 TAAATGCCCAGAGCCCCTTTGGG - Exonic
1127552574 15:60055624-60055646 GAAAAGGGCACACCTCTTTTGGG + Intronic
1129119037 15:73383903-73383925 GAAGAGGGCAGAGGTCCTGTAGG + Intergenic
1129360403 15:75020675-75020697 GAAATGGGCAGATGCTCTTTGGG - Exonic
1130907293 15:88249637-88249659 GAAATGGGAAGAGCCTCCTTGGG + Intronic
1133944936 16:10340215-10340237 GCAATGGGCAGGGCTCTGTTGGG + Intronic
1136098041 16:27973078-27973100 GAAATGGGCACAGCACCTGTAGG + Intronic
1137677368 16:50310344-50310366 GAGCAGGGCAGAGGTCCTTTGGG + Intronic
1140656844 16:77149849-77149871 GAAATGGCGATAGCTCCCTTTGG - Intergenic
1141399563 16:83735274-83735296 GGACTGGGGAGAGGTCCTTTGGG - Intronic
1142643289 17:1297075-1297097 GAAATGGGCAGAGATCCTTGGGG - Intronic
1143214306 17:5212964-5212986 GAAATTAGCAGAACTACTTTAGG + Intronic
1146110570 17:30085320-30085342 GAAATAGACAGAGGTGCTTTGGG - Intronic
1147702766 17:42406201-42406223 GAAATGGGCGGAGCGCCCTCTGG + Intronic
1147921735 17:43921352-43921374 GAAATGAGAAAAGTTCCTTTGGG - Intergenic
1148046974 17:44750170-44750192 GAAATGGGGGGAGGTCCTTGGGG - Intronic
1148906586 17:50916242-50916264 AAAATGGGCACAGCTGCTCTTGG - Intergenic
1150636347 17:66915855-66915877 GAGATTGGCAGAGACCCTTTGGG - Intergenic
1151139286 17:71976202-71976224 GAACTGGGCAGCGCTGCTTCTGG - Intergenic
1152411355 17:80124996-80125018 GAAATAGACAGAACTCCTGTCGG + Intergenic
1154261149 18:12833982-12834004 TAAATGGGCAGGGCTCCTTCAGG + Intronic
1158048465 18:53186475-53186497 GACATGAGCTGAGCTGCTTTAGG + Intronic
1158233886 18:55290618-55290640 GAAATAAGAAGAGCGCCTTTAGG - Intronic
1158711230 18:59839904-59839926 GCAATGGAGAGAGCTACTTTGGG + Intergenic
1158872807 18:61704866-61704888 GTATTGGGCAGAGCCCCTTCTGG - Intergenic
1162151137 19:8646498-8646520 GAAACAGTCAGAACTCCTTTGGG - Intergenic
1163145802 19:15378942-15378964 GACATTGGCAGTTCTCCTTTAGG - Intronic
1163513506 19:17749327-17749349 GAAATGGGCTGAATTCCTCTGGG + Intronic
1164613190 19:29647380-29647402 GAGATGGGCAGAGCTCCAAGTGG - Intergenic
1166999962 19:46739932-46739954 GAAATGGGCCCAGTTCCTTACGG + Intronic
1168632337 19:57967286-57967308 GAAATGGGCACAGCTCCTGGAGG + Intronic
925192800 2:1899043-1899065 AACATGGGCAGAGCCCATTTGGG + Intronic
927511496 2:23646952-23646974 GCAATAGCCAGAGCTGCTTTTGG - Intronic
928617102 2:33051691-33051713 GAAGTGTGCAGAGCTGCTCTGGG + Intronic
929827263 2:45318724-45318746 GCTTTGGGCAGAGCACCTTTGGG - Intergenic
933657385 2:84900368-84900390 GAAATGGAATGAGCTACTTTGGG - Intronic
938937389 2:136138895-136138917 GAAATGTGCATAGTTACTTTGGG + Intergenic
944276939 2:197849772-197849794 GAACTGAGCACATCTCCTTTAGG + Intronic
945471992 2:210237947-210237969 TAAATGGCCATAGATCCTTTTGG + Intergenic
946043157 2:216799864-216799886 GAAATGGGCAGAGAACCAGTGGG + Intergenic
1168803037 20:655672-655694 GGAATGGGCAGAGCTCCCACAGG - Intronic
1172729964 20:37078771-37078793 GAAATGGGCAGTTTTCATTTTGG + Intronic
1173315775 20:41941808-41941830 GGAAAGGGTAGAGCTTCTTTGGG - Intergenic
1173428046 20:42959717-42959739 GAAGGGAGCAGAGCTCCCTTGGG - Intronic
1173702944 20:45089182-45089204 GAAATGGCCACAGATCCTTTTGG - Intergenic
1176937556 21:14884356-14884378 GGAAAGGCAAGAGCTCCTTTGGG - Intergenic
1178124494 21:29502256-29502278 GAAAGGGACAGAGCACCTTTGGG - Intronic
1179255362 21:39711145-39711167 GATGTGGGCAGAGCTCGTCTGGG + Intergenic
1180229133 21:46415936-46415958 GAAATGTGCAGGGCTCATTGTGG + Intronic
1181414636 22:22750536-22750558 GAATTGGGCAGAGGTCCCTGAGG - Intronic
1183096252 22:35554034-35554056 GAAAGGGGCACACCTCCTCTTGG - Intergenic
1183174878 22:36215834-36215856 GATATGGGCAAATCTCCTGTAGG + Intergenic
949631342 3:5930677-5930699 GGAATGGCCTGAGCTGCTTTGGG - Intergenic
952787375 3:37168538-37168560 TTAATGGGCAGAGCTTGTTTAGG + Intronic
952802703 3:37311461-37311483 GAAATGGATCGAGCTCCATTGGG - Intronic
953262192 3:41350789-41350811 GAAATGTGCAGATTTCTTTTTGG + Intronic
953716642 3:45321695-45321717 TAAAACGGCAGAGCTCCTGTTGG + Intergenic
954990945 3:54840260-54840282 GCAATGTGCAGAGCTCTTTATGG + Intronic
955892739 3:63667248-63667270 GAAATGTGCACAGCTATTTTTGG - Intronic
959318606 3:104842194-104842216 AAAATGGACAGCCCTCCTTTGGG - Intergenic
960380840 3:116959572-116959594 GAATTGAGAAGAGATCCTTTGGG + Intronic
961361322 3:126369862-126369884 GAAATGGGCAAGACTCCTCTAGG - Intergenic
963258402 3:143169291-143169313 AAAATGGGCTGAGAACCTTTGGG + Intergenic
963328535 3:143888925-143888947 GAAATGGGCAGAGATCTATGAGG - Intergenic
964469318 3:157035565-157035587 GAAATTGGAAGAGCCCCTTCTGG + Intronic
966327060 3:178768680-178768702 GAAATGGGCAGAGCTCCTTTAGG - Intronic
966672314 3:182540912-182540934 GAAAAGGCCAGAGGTACTTTTGG - Intergenic
966740320 3:183226678-183226700 GAAATGGGCAAAGTTCCTGTGGG - Intronic
967554716 3:190842126-190842148 GAAATGGGCATAGTGACTTTGGG - Intergenic
969204576 4:5633739-5633761 GCAAAGGCCAGAGCTCCTTCAGG + Intronic
969868398 4:10090287-10090309 GAAATGGGCACAGCTCACCTTGG - Intronic
972416251 4:38843376-38843398 GCAATGTGCAGTGCTCATTTTGG - Intronic
979274950 4:118805036-118805058 GAAATGGACAAAGCTCACTTGGG + Intronic
983141417 4:164154619-164154641 GAAATGAGGGGAGCTCTTTTGGG + Intronic
983944723 4:173572740-173572762 GAAAAGGGAAGAGATCATTTTGG - Intergenic
985923225 5:2995861-2995883 GCAATGGGCAGAGCTCCTCAGGG + Intergenic
993280599 5:85920558-85920580 GAAAAGTGCAGAGCTGCTATTGG - Intergenic
993340853 5:86723589-86723611 GAGGTGGGCAGATCACCTTTGGG - Intergenic
994908160 5:105867743-105867765 GAAATGGACTGAGGTCTTTTGGG + Intergenic
994980394 5:106867563-106867585 GAAATGCGCTAATCTCCTTTAGG + Intergenic
996883335 5:128326308-128326330 AGAATGGGGAGAGCTCCTCTGGG + Intronic
998858958 5:146424397-146424419 GAAATGGGGAGAGGGCCTTCAGG - Intergenic
1001545702 5:172569426-172569448 CCAATGGGCAGGGCTCCGTTAGG - Intergenic
1002023881 5:176383775-176383797 GAAATGGGCAGAGAGCCATCGGG + Intronic
1003153296 6:3570978-3571000 GGAATGGGCAGGGCTGCTTGGGG - Intergenic
1007187344 6:39983499-39983521 GAAATGGGCAGTTCTTCTGTTGG + Intergenic
1009890663 6:69677287-69677309 GTATAGGGCAGAACTCCTTTTGG + Intronic
1010072717 6:71762670-71762692 GAAATGGGCAGAGGGCTTTGGGG - Intergenic
1010802480 6:80193051-80193073 GAGATGGGCAGATCACCTTGGGG - Intronic
1011653265 6:89526508-89526530 GAAATGGGCAGAATTCCACTAGG - Intronic
1011844255 6:91543329-91543351 CAAATGGACAGAGATCATTTAGG - Intergenic
1015170759 6:130249952-130249974 TAAATGGGGAGCCCTCCTTTAGG - Intronic
1015938641 6:138427068-138427090 GAAATGAGCAGAGCTGCTTTGGG - Intronic
1017409833 6:154156426-154156448 GAAATGGGCAGAGAGCCGCTGGG + Intronic
1019334006 7:474354-474376 GACATGGGCTCAGCTCCTTTTGG + Intergenic
1020092723 7:5350346-5350368 CAAATTGGCAGAGATCCTTTTGG - Intronic
1021461124 7:20888203-20888225 GAAATGGGCAGGGGTTCTTAAGG + Intergenic
1022499114 7:30871537-30871559 GAAATGGGCTGAGCACCGCTAGG - Intronic
1024337743 7:48226327-48226349 GAAATGGAAAGAGCTCATTCTGG + Intronic
1024741815 7:52362923-52362945 GCAGGGGGCAGAGCTCCTTGGGG - Intergenic
1025606987 7:63046526-63046548 TAAGTGGGCAGAGCACTTTTTGG - Intergenic
1028124365 7:87094769-87094791 GCAAGGGGCAGGGGTCCTTTTGG + Intergenic
1029583127 7:101450574-101450596 GCAAAGGCCAGACCTCCTTTAGG + Intronic
1030116548 7:106065948-106065970 GGAATGAGCGGAGTTCCTTTTGG + Intergenic
1030117188 7:106070860-106070882 GGAATGGGTAGTGCTCTTTTTGG + Intergenic
1032382843 7:131502636-131502658 AAAATGGGCAGAACTGCTTAGGG - Intronic
1032554032 7:132812860-132812882 GGAAGGAGCTGAGCTCCTTTGGG - Intronic
1034350327 7:150411035-150411057 GACATTGGCAGAGGTCCCTTGGG + Intronic
1037690826 8:21180036-21180058 GAAATGGGAAGAGCTGTTCTAGG + Intergenic
1039928670 8:41962367-41962389 GAAATAGGAAGAGCACATTTGGG - Intronic
1043595705 8:81882312-81882334 GAAATGGGTGTAGCTCCTTCAGG + Intergenic
1043607401 8:82019015-82019037 CCAACAGGCAGAGCTCCTTTTGG - Intergenic
1044798033 8:95923971-95923993 GCAGTGGGCAGAGTTCCTTTAGG - Intergenic
1050514869 9:6432821-6432843 AAAATGGCCAGAGCCCTTTTAGG - Intronic
1050975220 9:11928945-11928967 GAAGGGGGCAGAGCTCGTTGGGG + Intergenic
1052118900 9:24684198-24684220 GAAATGGCCACAGGTTCTTTTGG + Intergenic
1055483984 9:76739007-76739029 GAAGTGGGCAGAGCTGGTGTTGG + Intronic
1057466107 9:95316507-95316529 CAAATGAGCAGAGCACTTTTGGG - Intronic
1060191540 9:121596820-121596842 GAAATGGGTAGAGCCACTCTGGG - Intronic
1060473448 9:123967691-123967713 GAACTATGCAGAGCTCCTTGAGG + Intergenic
1060939780 9:127536584-127536606 GAAATGGAAAGAGCTGCTGTGGG - Intronic
1061838566 9:133344691-133344713 CAGCTGGGCAGAGCTCCTGTGGG + Intronic
1062010832 9:134265797-134265819 GGAATGGTCAGAGCTCCCTTTGG - Intergenic
1186489645 X:9961460-9961482 GACATGGACACAGCTCCTCTCGG - Intergenic
1187129287 X:16486284-16486306 TAAAAGGGCACAGCTGCTTTGGG + Intergenic
1187445317 X:19355884-19355906 GAAGGGAGCAGGGCTCCTTTGGG + Intronic
1190408554 X:50111926-50111948 TACAAGGACAGAGCTCCTTTGGG - Intergenic
1195085194 X:101407328-101407350 GAACCGGGCAGGGCTACTTTGGG + Intronic
1196840166 X:119852596-119852618 GAAATGGGGAGAGCCCCTCCCGG - Intronic
1198534182 X:137570227-137570249 GAAAAGGGCATGGCTACTTTTGG - Exonic
1200540848 Y:4453921-4453943 CAAAGAGGGAGAGCTCCTTTTGG - Intergenic
1201234655 Y:11897500-11897522 AAGATGGGCAGAGATGCTTTGGG - Intergenic