ID: 966328905

View in Genome Browser
Species Human (GRCh38)
Location 3:178789597-178789619
Sequence GAGAAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 3, 2: 12, 3: 73, 4: 368}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966328901_966328905 22 Left 966328901 3:178789552-178789574 CCCTGGCAGAAGCTGCATGGCAC 0: 1
1: 1
2: 14
3: 59
4: 289
Right 966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG 0: 1
1: 3
2: 12
3: 73
4: 368
966328902_966328905 21 Left 966328902 3:178789553-178789575 CCTGGCAGAAGCTGCATGGCACA 0: 1
1: 4
2: 11
3: 43
4: 338
Right 966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG 0: 1
1: 3
2: 12
3: 73
4: 368
966328898_966328905 27 Left 966328898 3:178789547-178789569 CCATCCCCTGGCAGAAGCTGCAT 0: 1
1: 1
2: 13
3: 65
4: 385
Right 966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG 0: 1
1: 3
2: 12
3: 73
4: 368
966328900_966328905 23 Left 966328900 3:178789551-178789573 CCCCTGGCAGAAGCTGCATGGCA 0: 1
1: 1
2: 16
3: 47
4: 308
Right 966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG 0: 1
1: 3
2: 12
3: 73
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966328905 Original CRISPR GAGAAGAGCACAGTGATTGT GGG Intronic
904424591 1:30415301-30415323 GGGAAGAGCAGAGTCATGGTAGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906787794 1:48630948-48630970 GAGTAAAGCACAGGGGTTGTGGG - Intronic
906809797 1:48814181-48814203 GAGAAGAGCAAAGAGATTCAAGG - Intronic
907622701 1:55997747-55997769 TAGAACAGCACAGTGCTTGAAGG + Intergenic
907634516 1:56120199-56120221 CAGAGAAGCACAGGGATTGTGGG - Intergenic
907911904 1:58834346-58834368 GAGGGAAGCACAGGGATTGTGGG + Intergenic
908022732 1:59915127-59915149 CAGGAGAGCAGAGTGATAGTGGG - Intronic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910242706 1:85104660-85104682 GAGAAGAAGACACTGATTTTAGG - Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910468060 1:87521842-87521864 CAAAAGAGCACATTGATTTTGGG + Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911019729 1:93374634-93374656 GGGGAGAGCACAGTTATTATGGG + Intergenic
911230003 1:95351080-95351102 GAGAAGAGGGAAGAGATTGTGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915324945 1:155076948-155076970 GAGAAGGGCTCAGTTATTATTGG + Intergenic
915578368 1:156796831-156796853 GAGATGGGCACAGGGATTGTGGG + Intronic
915614020 1:157021175-157021197 GAGAAGAACACAGAGATTTCAGG + Intronic
915930260 1:160056195-160056217 GAGATGAGCACAGTGAGCCTGGG - Intronic
916345630 1:163788149-163788171 GAGGAGAGCACAGTCAATGCAGG - Intergenic
917275878 1:173331555-173331577 GAAAAGAGCAAAGTGATTAATGG + Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917483412 1:175432780-175432802 GAGAAGAGGAGAGTGAATATTGG - Intronic
918683205 1:187381572-187381594 AAGAAGACCACAGTTATTGATGG + Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
921002146 1:211055257-211055279 AGGAAAAACACAGTGATTGTGGG + Intronic
922532132 1:226352843-226352865 GCGAAGAGCTCCGTGATTTTTGG + Intergenic
922579845 1:226688729-226688751 GAGAAGGGTACAAAGATTGTTGG - Intronic
923190360 1:231614403-231614425 GAGAAGTGCAGAGTGAAGGTGGG - Intronic
923688810 1:236173610-236173632 GGGAAGACCACATTGCTTGTGGG - Intronic
923778747 1:237002585-237002607 GAGAACAGCAAAGTGAGTGGAGG + Intergenic
923917388 1:238524362-238524384 GAGAAGAACACAGTGGTTTGGGG + Intergenic
924108224 1:240671019-240671041 GAAAAGGGAACAGTGATGGTGGG - Intergenic
924956594 1:248934193-248934215 GAGAACAGCACAATGATACTTGG - Intergenic
1063607969 10:7539635-7539657 GAGAAGAGCAGATAGATGGTGGG + Intergenic
1063969944 10:11374616-11374638 AAGAGGAGCACAGTGGTTCTTGG + Intergenic
1064301281 10:14125174-14125196 GAGAAGAGCATAGTCATCGACGG - Intronic
1066132170 10:32404915-32404937 CAGAAGAGCACAGATGTTGTGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068064690 10:52114605-52114627 GAGAAGTGCACAATAATTGTTGG + Intronic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069631012 10:69897074-69897096 GGGAAGAGCACAGTGACAGAAGG + Intronic
1069729121 10:70599806-70599828 GAGAAAGGCACAGTGTTTGTAGG - Intronic
1071799309 10:89041846-89041868 GAGAAGAGAAGAATAATTGTTGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1074054497 10:109910139-109910161 TAGAAAAGCTCAGTTATTGTCGG - Intronic
1074279413 10:112036845-112036867 GAGAAGAGCAAAGAGGCTGTTGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075262560 10:120975937-120975959 AAGAGGAGCACAGTGAATGAAGG - Intergenic
1075688523 10:124380055-124380077 GAGAAGAGCACAGAGGAGGTGGG - Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077726430 11:4679521-4679543 TAGAAGAGGACTGAGATTGTGGG + Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078141369 11:8695572-8695594 GGGAAGAGAACAGTCATTGGAGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079745398 11:24121836-24121858 GAGATGAGCACAGGGACAGTAGG - Intergenic
1079758768 11:24302212-24302234 GAGAAGAGCACCCAGATGGTTGG - Intergenic
1079844356 11:25446173-25446195 GAGCAGAGCATAGTGATGTTTGG + Intergenic
1080396810 11:31897809-31897831 GAGGAGAGCTCAGTTAGTGTGGG - Intronic
1080600522 11:33817646-33817668 GCATAGAGCACAGTCATTGTGGG + Intergenic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081555623 11:44157943-44157965 GAGAAGGGCCCAGTGCTGGTAGG - Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083969798 11:66067980-66068002 GAGAAGAGAACAGCCACTGTTGG + Exonic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088715791 11:112548246-112548268 GAGAAGAGCACAGAAACTGAAGG - Intergenic
1088890413 11:114039757-114039779 GAGAAGAGCTCTGTAAGTGTTGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089031342 11:115332656-115332678 GAGAAGATCATATTGATTATAGG + Intronic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094258372 12:28463228-28463250 GAAATGAGCACAGTGTTTGGTGG + Intronic
1095196362 12:39323266-39323288 CAGGAGAGCACAGTAAATGTTGG - Intronic
1095535469 12:43240877-43240899 GAGTAGAGGACAGTGGTTGATGG + Intergenic
1095611614 12:44135101-44135123 GAAAATAACCCAGTGATTGTTGG - Intronic
1095625001 12:44304194-44304216 GAGGAGAGCACAGTGACTATGGG + Intronic
1095641007 12:44484658-44484680 GAGAAGTGCAGAGTGAAGGTGGG + Intergenic
1095709466 12:45273116-45273138 GAGAATAGAACAGTGATTGCCGG + Intronic
1095826756 12:46537779-46537801 GAGAATAGCAGAGTGATGCTGGG + Intergenic
1095874798 12:47068623-47068645 GATGAGAGCACAGGGAGTGTGGG + Intergenic
1098085256 12:66835715-66835737 GTAAAAAGAACAGTGATTGTTGG + Intergenic
1098090186 12:66893086-66893108 GAGAACAGATCAGTGGTTGTTGG - Intergenic
1098100201 12:67007127-67007149 GAGGAGAGCACAGTGGTGATGGG + Intergenic
1098192538 12:67965670-67965692 GAGAAGAGCACTGTTTTTGCAGG - Intergenic
1099278893 12:80617067-80617089 CAGCAGAGCACAGTGATTAAAGG + Intronic
1099990175 12:89712991-89713013 TAGAAGAGCACATTGTATGTAGG - Intergenic
1100652492 12:96605693-96605715 GAGAAGTCCATAGTAATTGTAGG + Intronic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1101665345 12:106807667-106807689 GAGAAAAGGACAGTGAGTTTTGG + Intronic
1102082932 12:110113016-110113038 CTGAAGAGCACAGTGATGGAGGG + Intergenic
1102262109 12:111449440-111449462 TAGAACAGAACACTGATTGTGGG - Exonic
1103346243 12:120252248-120252270 GAGAACAGCACAGTGCTTGGTGG + Intronic
1107447186 13:40479831-40479853 GAGAAAAGGACAGTGGTTTTCGG + Intergenic
1108623290 13:52204540-52204562 CAGAAGAGAGCAGTGAGTGTTGG - Intergenic
1108663439 13:52606497-52606519 CAGAAGAGAGCAGTGAGTGTTGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1111073659 13:83204075-83204097 GAGCAAAGCACAATGATTGAAGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112304293 13:98259739-98259761 GAGAAGGGGACAGAGGTTGTTGG + Intronic
1112974101 13:105295496-105295518 GAGAAGTGCAGAGTGAAGGTGGG - Intergenic
1113301583 13:109027439-109027461 GAGAAAAGCACAGTGAACTTGGG - Intronic
1113776681 13:112951630-112951652 GAGAATAGTTCAGTGGTTGTGGG + Intronic
1114189274 14:20428779-20428801 GAGAGAAGGACAGAGATTGTGGG - Intergenic
1114303037 14:21395306-21395328 GAGGAGATCTCAGTGATTGATGG - Exonic
1114604040 14:23981711-23981733 CAGAAGAGCAGGGTGATAGTGGG + Intronic
1114609060 14:24024510-24024532 CAGAAGAGCAGGGTGATAGTGGG + Intergenic
1114821773 14:26029172-26029194 GAGAAAACCAAAGTGATTGATGG + Intergenic
1114991999 14:28298973-28298995 GAGAAGTGCAGAGTGAATGGGGG - Intergenic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116541806 14:46109268-46109290 CTGAAGAGCACAATGATTGTGGG + Intergenic
1116583586 14:46674299-46674321 GAGGGAAGCACAGTGATTGAAGG + Intergenic
1116862970 14:50009051-50009073 CAGAACAGCACAGTGAGTTTGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117411999 14:55458478-55458500 CAGAAATGCACAGTGATTTTTGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118367268 14:65106582-65106604 GAGAAAAGCACAGGAATTCTTGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119126730 14:72134269-72134291 GAGAAGCCCTCAGTGAATGTGGG - Intronic
1121875217 14:97445288-97445310 TAGAAGAGGGCAGTCATTGTAGG - Intergenic
1124344165 15:28910369-28910391 GAAAAGTGCTCAGTGATTGGTGG + Intronic
1124962067 15:34406166-34406188 GAAAAGTGCTCAGTGATTGGTGG + Intronic
1124978690 15:34552387-34552409 GAAAAGTGCTCAGTGATTGGTGG + Intronic
1125271505 15:37943737-37943759 GGAAAGAGTACTGTGATTGTAGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1127140270 15:55969129-55969151 ACGAAGGGCAAAGTGATTGTGGG + Intronic
1127225759 15:56926740-56926762 GTGAATAGCACAGTGATCTTGGG + Intronic
1127737515 15:61857986-61858008 GAGATTGCCACAGTGATTGTAGG - Intronic
1129771955 15:78208273-78208295 GACAAGACCTCAGTGGTTGTAGG + Intronic
1129856717 15:78830338-78830360 GAGCAGACCACAGTGAAGGTGGG + Intronic
1133898129 16:9948769-9948791 GAGAAGAGCACAGAGAGAGAAGG + Intronic
1134287154 16:12871875-12871897 GAGAAGAGAAAAGTCAGTGTAGG + Intergenic
1135423243 16:22318440-22318462 GAGCAGAGCACAGTGATTGAGGG + Intronic
1139439094 16:66955594-66955616 CAGAAGAGCAGGGTGATAGTGGG + Intergenic
1139702795 16:68719411-68719433 GAAAAGGGCCCAGTGGTTGTCGG + Intronic
1140115886 16:72041143-72041165 GAGAAGTGCAGAGTGAAGGTCGG + Intergenic
1141862362 16:86726556-86726578 CAGACAAGCACAGGGATTGTTGG - Intergenic
1142727789 17:1829512-1829534 GAGAAGAGGACAGTGTGTGGGGG - Intronic
1143162795 17:4882201-4882223 GAGCAGAGCACAGTGAGAGGAGG - Intronic
1144517612 17:15929506-15929528 GAGGAGAGCACAGTGCTCCTTGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145722168 17:27083384-27083406 GAGGAGACCCCAGTCATTGTAGG - Intergenic
1145857369 17:28174099-28174121 GAGCAGTGCACAGTGACTTTTGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1147497416 17:40930113-40930135 GAGAAGAGTGCACTCATTGTTGG + Intronic
1147648481 17:42048647-42048669 TAGAAGAGAACAGGGATTGAAGG - Intronic
1148679824 17:49467215-49467237 GAGAAGGACACAGAGAATGTAGG - Intronic
1149027265 17:52041723-52041745 GAGCAGAGCACAGTGAAAATGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150739073 17:67765090-67765112 GAGAAGAGCAGATGGATTGGAGG - Intergenic
1151426592 17:74034746-74034768 GAGAAGAGCAGAGCAATTGAAGG - Intergenic
1152004616 17:77672252-77672274 GAGAAGGGGACAATGAGTGTGGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153765370 18:8369556-8369578 AGGAAGAGCGCAGTGACTGTGGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1158261252 18:55608531-55608553 GAGATGAGCACATTTATTTTTGG + Intronic
1158660382 18:59381945-59381967 GAGAGGATGACAGTGATTATTGG + Intergenic
1159285042 18:66337554-66337576 GGGAAGAGCTCAGTGACTGTGGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1160449379 18:78951842-78951864 GAGAAGTGCAGAGTGAATGGGGG + Intergenic
1161466238 19:4432196-4432218 GAGACGAGCAGAGTGAGTGTGGG + Exonic
1161737319 19:5999392-5999414 GAGAAGAGCAGAGTGAGCGCAGG - Intronic
1164695520 19:30240793-30240815 GTGAAGGGCACAGTGTTTGGTGG + Intronic
925766542 2:7241849-7241871 GAGAACAGGACAGAGATGGTGGG - Intergenic
926117300 2:10221550-10221572 GAGAAAAACACAGTCATTATGGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
926702406 2:15812189-15812211 TACAAGAGCGCAGTGAGTGTGGG - Intergenic
926834276 2:17000261-17000283 GAGAAAAGCACAGTGAAGGGAGG + Intergenic
927238246 2:20897897-20897919 GAAAAGAACAGAGTGATTTTAGG - Intergenic
927442113 2:23126376-23126398 GGGAAGAGGACTGTGAGTGTGGG - Intergenic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928574055 2:32636919-32636941 GAGGACAGCATAGTGTTTGTGGG + Intronic
928885165 2:36140064-36140086 GAGAAATGCTCAGTAATTGTCGG - Intergenic
929192211 2:39150100-39150122 GAGAAGAGCCCTGAGATTATCGG + Intergenic
930072169 2:47375432-47375454 AAGAATAGCACAGAGATTCTGGG + Intronic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930504177 2:52261465-52261487 GAGAAGACTAAGGTGATTGTTGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
932278184 2:70467247-70467269 GAGAGCAGCACAGTCAGTGTTGG + Intronic
933909669 2:86928862-86928884 GAGAAGAGCACAGAAGTTTTTGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935560239 2:104551717-104551739 GAGATCTGCACTGTGATTGTGGG + Intergenic
936413485 2:112281796-112281818 GAGAAGAGCACAGAAGTTTTTGG + Intronic
938120102 2:128627069-128627091 AAGAAGAGACCAGTGATTCTTGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941169569 2:162120199-162120221 GAAAAGAGCAGAGTGTTGGTTGG - Intergenic
941472957 2:165912831-165912853 GACAAGAGCACAGTTAATATGGG - Intronic
941512887 2:166436342-166436364 GAGAAGTGCAGAGTGAAGGTGGG - Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942043638 2:172086665-172086687 GAGAAGAGCACGGTGGTGGAAGG + Exonic
942153324 2:173100900-173100922 GAAAAGAGCAGAGTGATGGATGG - Intronic
942741156 2:179179821-179179843 GAGAGGAGCACAGTGCTGGGAGG - Intronic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943687798 2:190837471-190837493 GAGAAATAGACAGTGATTGTTGG + Intergenic
943794410 2:191973857-191973879 GAGAAGTGCAGAGTGAAGGTGGG - Intronic
944753546 2:202736316-202736338 GATGAGAGGACAGTGATTGCTGG + Intronic
945556272 2:211280343-211280365 TAAAAGAGCTCAGTGATTCTAGG + Intergenic
945571065 2:211468473-211468495 GAGAACAGCACCGTGCTTATAGG + Intronic
946933387 2:224694272-224694294 GAGAACATCAGAGTGATGGTAGG + Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1168918697 20:1513071-1513093 GAGAAGTGCAGAGTGAAGGTGGG + Intergenic
1168985459 20:2044675-2044697 GAGAAGCTCACAGTGATTTTGGG - Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170708583 20:18768258-18768280 GAAAAGAACACAGTGATCATTGG - Intergenic
1171465374 20:25324198-25324220 GAGAGGAGCAAGGTGACTGTGGG + Intronic
1173320724 20:41984711-41984733 GAGAAGGGCACAGTGGTAATTGG - Intergenic
1173462502 20:43254536-43254558 GTGAAAAGCACAGTGCTTGTAGG - Intergenic
1174964498 20:55196697-55196719 GAGAAGGGCAGAGTGAAGGTGGG - Intergenic
1177603339 21:23344743-23344765 GAGAAGTGCCCAGTGAAGGTGGG - Intergenic
1177786904 21:25681417-25681439 GAGAAGTGCAGAGTGAAGGTGGG + Intronic
1181892427 22:26075415-26075437 GAGAAGATGACACTGAGTGTGGG + Intergenic
1182399155 22:30061191-30061213 AAGAAGAGAACAGTCCTTGTGGG - Intergenic
1182762101 22:32731004-32731026 GAGAAAAGCACAGGGACTCTGGG - Intronic
1184313453 22:43664170-43664192 GAGAAGAGCACAGGGGTTGGAGG + Intronic
1184861279 22:47174487-47174509 GAGAAGAGCACTGTGGTTCAGGG - Exonic
1185219995 22:49624415-49624437 GGGGAGAGCACAGTGATGCTCGG + Exonic
949216829 3:1580968-1580990 TAGCAGAGCTCAGTTATTGTGGG - Intergenic
949978377 3:9481605-9481627 GAGGAGAGCATAGTCATTGAAGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951576955 3:24123787-24123809 GAGAAGAGAACAGCTATAGTGGG + Intronic
952176265 3:30866622-30866644 GAGAGGACCACAGTGGTTGGGGG + Intronic
952567442 3:34676024-34676046 GAGAAGAGGAAAGAGATTGCTGG + Intergenic
952595136 3:35008477-35008499 GAAAAGAGCACAGTTGGTGTGGG - Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953610783 3:44445712-44445734 GAGAAGAGCAGAGGGAGTGCTGG - Exonic
954436542 3:50499245-50499267 GAAAAGAGCACAGTCATGGCAGG + Intronic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957815982 3:85297679-85297701 GAGAAAAGCAGGCTGATTGTGGG - Intronic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958777297 3:98501406-98501428 GAGAAGAGGAAAGAGGTTGTAGG - Intronic
959011983 3:101088094-101088116 GATAAAGGCACAGTGATTATGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959732464 3:109619562-109619584 GAGAATAGCACAGTTCTTCTAGG - Intergenic
959754530 3:109882058-109882080 GAGAAGAGGACTGTATTTGTAGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960052124 3:113249088-113249110 GAGGAGAGCAGGGTGATTGCAGG + Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961644302 3:128384441-128384463 GACCAGAGCAGAGTGAGTGTGGG + Intronic
961779093 3:129311125-129311147 GAGCTGAGCACAGGGACTGTTGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963914936 3:150850418-150850440 GAGAAGTGCAAAGTGAATGGGGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964432078 3:156617817-156617839 GGGCAGAGCACAGGAATTGTTGG + Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965352191 3:167627222-167627244 CAGAAGATGACAGAGATTGTTGG - Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968218459 3:196914930-196914952 AGGAAGAGCAAAATGATTGTGGG + Intronic
968410677 4:387060-387082 GAGAAGAGCGCTGAGCTTGTGGG + Intergenic
969601721 4:8180235-8180257 GAGCAGTGCCCAGTGAATGTGGG + Intergenic
970363688 4:15336788-15336810 GAGGAGAGGACATTGATTCTTGG - Intergenic
970402805 4:15734153-15734175 GAGAGCAGACCAGTGATTGTGGG + Intronic
971268270 4:25113538-25113560 GAAAAGAGCAGAGTGAATTTGGG - Intergenic
971706503 4:30049963-30049985 GAAAAGAGAACATTGCTTGTGGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972368054 4:38394382-38394404 GTGAAGAGGAGAGAGATTGTTGG + Intergenic
972380264 4:38512823-38512845 GAGGAAAGCACAGTGAGTTTGGG - Intergenic
973169468 4:47121265-47121287 AAGAAAAGCACAGCAATTGTGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974214641 4:58829082-58829104 GAGAAGTGCAGAGTGATTTGGGG + Intergenic
974606535 4:64159131-64159153 GATAAGAACACAGGGGTTGTGGG - Intergenic
974845079 4:67342175-67342197 GAAAACAGCTCATTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
977706279 4:100074534-100074556 GAGAAGAGCTCATTCATTGATGG - Intergenic
978006676 4:103625889-103625911 GATAAAAGCACAGTTATTTTTGG - Intronic
978055793 4:104264375-104264397 CAGAAGAGCACAGTGAATGAGGG - Intergenic
978445222 4:108773645-108773667 TAGAAGAGCACAGTAATACTTGG + Intergenic
978478245 4:109157137-109157159 AGGAAGAGCACAGTGACTGAAGG + Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980256292 4:130384002-130384024 GAGAATAGAACAGTGATTACTGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983755378 4:171328650-171328672 AGGAAGAGCAAAGTGAGTGTGGG + Intergenic
988249789 5:28741872-28741894 AAGAATAGCACAGTGATGATAGG - Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
988450128 5:31333772-31333794 GAGAAGTGCAGAGTGAAGGTGGG - Intergenic
989999325 5:50874776-50874798 GAGACGAGCACAGTGTCTTTGGG - Intergenic
990202965 5:53398311-53398333 AGGAAGACCATAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994009767 5:94887905-94887927 AAGAAGTGCACAGTGATTTCAGG + Intronic
995042306 5:107602858-107602880 TAGAAGAGCACAGTGACTAGAGG + Intronic
995132442 5:108644664-108644686 GAGAACAGGAGAGTGATTCTGGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995229626 5:109744400-109744422 GAGAAGAGAATGGTGATTATGGG + Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995750516 5:115449142-115449164 CAGAAGAGCAGGGTGATAGTGGG - Intergenic
995890362 5:116944295-116944317 GTGAAGAGCATGGTGATTCTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996906691 5:128608971-128608993 AAGAACAGCACAGTGACTGTGGG - Intronic
997016928 5:129947168-129947190 GAGAAGTGCCCAGTGATAGGGGG + Intronic
997574705 5:134965692-134965714 GAGAAGAGCCCAGTTGTTCTTGG - Exonic
998202943 5:140139762-140139784 GAGAACAGCAAAATGATTTTGGG - Intergenic
998216064 5:140239474-140239496 GAGAAGACCCCAGGGCTTGTTGG + Intronic
999520992 5:152350662-152350684 GATAAGAGCTCAGGGACTGTTGG + Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002073130 5:176692521-176692543 GTGAAGAGGACAGGGATTGTGGG + Intergenic
1003553444 6:7119602-7119624 GAGAAAAGCACAGTGTTTGGAGG + Intronic
1004017088 6:11742013-11742035 GGGAAAAGCTAAGTGATTGTAGG - Intronic
1004017092 6:11742046-11742068 GGGAAAAGCTAAGTGATTGTAGG - Intronic
1004945367 6:20606401-20606423 GAGAAGAGAACAGTTAAGGTCGG + Intronic
1005025177 6:21455764-21455786 GAGAAGAGGTCATTGGTTGTGGG - Intergenic
1005075591 6:21903480-21903502 AAGAAGATCCCAGTGATTATAGG + Intergenic
1005571897 6:27153347-27153369 AAGAAGAGGACAGTGAATCTAGG + Intergenic
1005887499 6:30107938-30107960 TAGAAGGGCCCAGGGATTGTTGG + Intronic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1012961661 6:105628713-105628735 GGGAAGAGCAGGGTGATTGCAGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1013985686 6:116190576-116190598 GAAAAGATGACAGTGGTTGTGGG + Intronic
1015270569 6:131333857-131333879 GAGAAGAGGACTGTGGTTGGAGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016031097 6:139339098-139339120 GAGAAGAGCTCAGTGTTTCTTGG + Intergenic
1016050323 6:139524045-139524067 GAGAAAAGCTCGGTGGTTGTGGG - Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017717066 6:157220099-157220121 GAAAAGAACACAGCCATTGTGGG - Intergenic
1018514438 6:164562925-164562947 GAGAAGTGCAGAGTGAATGGGGG - Intergenic
1021133845 7:16943012-16943034 GGGCAGAGCACAGTGCTTGCAGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024981315 7:55159596-55159618 GTGAAGAGCACAGTGAGTGTGGG - Intronic
1027515864 7:79140612-79140634 CAAAATAGCACAATGATTGTAGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028142468 7:87288747-87288769 GGGATGCGCACAGTGCTTGTGGG + Intergenic
1028284715 7:88981787-88981809 GAGGAGAGCACAGTGATCTTGGG - Intronic
1030431723 7:109456350-109456372 AAGAACAGCACAGTGATTATCGG - Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031758118 7:125673141-125673163 GATATGGGCACAGTAATTGTAGG + Intergenic
1031775119 7:125899244-125899266 GAGAATAGAACAGTGATTACCGG - Intergenic
1032062313 7:128735384-128735406 GAAAGGAGAACAGTGAGTGTTGG - Intergenic
1033011880 7:137631929-137631951 GAGAAGAGCACCAACATTGTTGG + Intronic
1033335401 7:140447897-140447919 GAGAAGAACAAAGGGATTGAAGG + Intergenic
1033712072 7:143958010-143958032 GAGAGGAGCACAGTGAGTCATGG + Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1037624375 8:20594411-20594433 GAGAAGAGCAGAGTTGATGTGGG + Intergenic
1037787781 8:21912668-21912690 GAGAAGAGGACAGTGACTGCAGG + Intronic
1039093530 8:33857899-33857921 GAGAACAGCACACTGACAGTGGG - Intergenic
1039117278 8:34105664-34105686 GAGAAGAGCACTGGGCTTATGGG + Intergenic
1039473996 8:37829803-37829825 GAGCAGAGCAGAGGGAGTGTGGG - Intronic
1039831056 8:41215353-41215375 GAGAACAGGTCAGTGATTGTGGG + Intergenic
1040317758 8:46273974-46273996 GATGAGACCACAGTGATTGCTGG + Intergenic
1040843580 8:51810658-51810680 GCCAAGAGCATAGTGATTGTTGG - Intergenic
1041276182 8:56159943-56159965 GAAAAGAGCACGGTGCTTGATGG - Intergenic
1041654611 8:60336331-60336353 GAGAAGTGCAGAGTGATGGGTGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043828954 8:84964717-84964739 CAGAAGAGCAGAATGATTCTAGG + Intergenic
1044126929 8:88470957-88470979 GAGAAGTGCAGAGTGAAGGTGGG + Intergenic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045168070 8:99629512-99629534 GGGAAGAGAGCAGTTATTGTGGG + Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047212478 8:122851019-122851041 GAGAAGACCACAATGATAGCTGG - Intronic
1047781231 8:128112928-128112950 GATAAGAACACAGTGATGGCTGG - Intergenic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1050068539 9:1786442-1786464 GAGAAGACCACAGTGATGGATGG - Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051785663 9:20740444-20740466 GATATGCACACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1053017123 9:34668235-34668257 AAGAAGAGAACAGTGCATGTGGG - Intergenic
1053451586 9:38198161-38198183 GAGAAGAGTACAGACACTGTCGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055164877 9:73178965-73178987 GAGAAGAACAGAGAGATCGTTGG + Intergenic
1055329931 9:75173257-75173279 GAGAAGAGAATAGTTATTATGGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056314851 9:85378098-85378120 GAGACCAGCACAGTGATAGAAGG - Intergenic
1057431927 9:95002960-95002982 TAGAAGAGCAGAGTGACAGTAGG + Intronic
1057852412 9:98575822-98575844 GAGCAGGCCACACTGATTGTGGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060084945 9:120689821-120689843 GAGAAGAGCATAATGACTTTAGG - Intronic
1060464532 9:123891189-123891211 GAGAGGAGCTCAGTGCTTCTGGG - Intronic
1062222975 9:135429102-135429124 GAGAGTAGAACGGTGATTGTGGG + Intergenic
1062227842 9:135463704-135463726 GTGAAGGGCACTGTGGTTGTGGG + Intergenic
1185852127 X:3498993-3499015 TACAAGAGCAAAGTGATTTTTGG + Intergenic
1186158806 X:6754268-6754290 GAGAAGTGCACAGTGAAGTTGGG - Intergenic
1186173883 X:6904953-6904975 GAGCAGTGGACAGTGAGTGTTGG - Intergenic
1186387047 X:9120591-9120613 GAGAAAAGCACAGTGATTCACGG + Intronic
1186434820 X:9533659-9533681 AAGAAAGGCACAGTGATGGTGGG + Intronic
1186755572 X:12667880-12667902 GAGATGAGCACTGTGATTCAGGG + Intronic
1187564550 X:20435473-20435495 GAGAACAGCACAGAGAGTTTTGG + Intergenic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187658606 X:21511659-21511681 GAGAAAAGCACAGTGTTTGAAGG + Intronic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188881141 X:35493289-35493311 AAGAAGAGCACTGTGCATGTGGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189124200 X:38428618-38428640 GTGAAGAACACAATGATTTTTGG + Intronic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190620940 X:52286246-52286268 GAAAAGAGCTCAGTGAATGATGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192489442 X:71562055-71562077 GTGTAGAGCACAGTGCTTATAGG + Intronic
1193083596 X:77428524-77428546 GAGAAGAGGCCAGTGATGGATGG - Intergenic
1193092432 X:77509625-77509647 GAAAAGAGTACAGTGATTATGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193931694 X:87561371-87561393 GGGGAAAGCAAAGTGATTGTAGG + Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1197950020 X:131884506-131884528 GAGAATTCCACAATGATTGTTGG + Intergenic
1198095491 X:133376234-133376256 GAGAAGGGCACTGTGTATGTTGG + Intronic
1198697362 X:139355765-139355787 GAGAAAAGCACAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic