ID: 966329483

View in Genome Browser
Species Human (GRCh38)
Location 3:178794755-178794777
Sequence GAGGGCTGGAACTCACAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966329477_966329483 -4 Left 966329477 3:178794736-178794758 CCTCTGTCTTGCTGGAAAGGAGG 0: 1
1: 0
2: 4
3: 17
4: 231
Right 966329483 3:178794755-178794777 GAGGGCTGGAACTCACAGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 240
966329472_966329483 4 Left 966329472 3:178794728-178794750 CCCAAAACCCTCTGTCTTGCTGG 0: 1
1: 0
2: 3
3: 14
4: 183
Right 966329483 3:178794755-178794777 GAGGGCTGGAACTCACAGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 240
966329474_966329483 3 Left 966329474 3:178794729-178794751 CCAAAACCCTCTGTCTTGCTGGA 0: 1
1: 0
2: 1
3: 20
4: 195
Right 966329483 3:178794755-178794777 GAGGGCTGGAACTCACAGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 240
966329476_966329483 -3 Left 966329476 3:178794735-178794757 CCCTCTGTCTTGCTGGAAAGGAG 0: 1
1: 0
2: 6
3: 61
4: 581
Right 966329483 3:178794755-178794777 GAGGGCTGGAACTCACAGGTGGG 0: 1
1: 0
2: 1
3: 26
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966329483 Original CRISPR GAGGGCTGGAACTCACAGGT GGG Intronic
900226605 1:1536095-1536117 GAGGCCTGGAGCTCACGGGAAGG + Intronic
900356288 1:2266379-2266401 GGCGGCTGGAATTCACAGGACGG - Intronic
900494615 1:2970899-2970921 GAGGGCTGGGAATCACTGGCTGG - Intergenic
900744328 1:4351072-4351094 CGGGGCTGGAAGTCACAGTTAGG + Intergenic
901181965 1:7348021-7348043 GAGGACTGGACCTCACAGCAAGG + Intronic
906155801 1:43613297-43613319 GAGGGGTGGGACGCCCAGGTCGG - Intronic
907436147 1:54449555-54449577 GAGGACTGGAGCTCAGAGGAGGG - Intergenic
908723224 1:67148195-67148217 GAGGGGTGGAAGTCAGTGGTGGG + Intronic
912285717 1:108366259-108366281 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
912570507 1:110617821-110617843 GAGGGATGGAGCTCACATGGTGG + Intronic
915479487 1:156175237-156175259 CAGGACTGGCACTCACAGGTTGG - Exonic
916033699 1:160902049-160902071 ATGGGCTGGAACTCAAAGGAGGG - Intergenic
916250487 1:162732951-162732973 GAGGGCTGGAGCTCCCTGCTGGG + Intronic
917413367 1:174783101-174783123 GAGGGCTGGAAGTCAACGGTGGG - Intronic
919704164 1:200660403-200660425 GAGGGGTGGGAGTGACAGGTGGG + Intronic
922685157 1:227633129-227633151 GAGGGGTGGAAGTCATTGGTGGG + Intronic
923037658 1:230295949-230295971 GAGTGCTGGGAGTGACAGGTGGG - Intergenic
924940461 1:248809840-248809862 GGGCACTTGAACTCACAGGTGGG - Intergenic
1064144851 10:12819401-12819423 GAGGGCAGGAACTGGCAGGCAGG + Intronic
1065199857 10:23301979-23302001 GAGGGATGGAAGTCAGCGGTGGG + Intronic
1067539382 10:47140715-47140737 GTGGGCTCGAACTCAAATGTTGG + Intergenic
1068650815 10:59520479-59520501 AAGGGCTGGAATTCACAGCCTGG + Intergenic
1069588497 10:69627308-69627330 GTGTGCTGGATCTCAAAGGTGGG - Intergenic
1073033894 10:100549562-100549584 CAGGGCTGCAGCTTACAGGTGGG + Exonic
1073191403 10:101653001-101653023 GTTGCCTGGAACTCACACGTGGG - Intronic
1073521973 10:104140540-104140562 GAGTGCTGGAATTAACAGGCAGG - Intronic
1074978463 10:118599856-118599878 GAGGGGTGGAAGTCAGAGGCGGG + Intergenic
1076002648 10:126924341-126924363 GAGTGCTGGAACTCAGTAGTGGG + Intronic
1076362856 10:129901819-129901841 GAGGGCTGCAACGCACAGTTGGG + Intronic
1076400411 10:130180304-130180326 AAGTGCTGGAATTTACAGGTAGG + Exonic
1079495817 11:21042788-21042810 CAGAGCTGGAACACACAGCTTGG - Intronic
1080016630 11:27514047-27514069 GATCTCTGGAACTCACAGATGGG - Intergenic
1080296729 11:30738457-30738479 GATGGCTGTCACTCATAGGTGGG - Intergenic
1082863088 11:57873841-57873863 GAGGCCTGAACCTCCCAGGTAGG - Intergenic
1083652432 11:64211215-64211237 CAGGGCTGGGACTCACGGGCCGG - Intronic
1084744061 11:71156401-71156423 GAGGGCGGAAACTCAGAGGCAGG - Intronic
1085406656 11:76267128-76267150 GAGGGTTGGGACTGACAGGAAGG + Intergenic
1088242927 11:107789662-107789684 GAGGGGTGGAAGTCAATGGTGGG - Intergenic
1089564088 11:119361715-119361737 CAGGGCTAGCACTAACAGGTAGG + Intronic
1091214945 11:133895164-133895186 GAGAGCTGGCTCTCACAGGGTGG + Intergenic
1091216698 11:133906695-133906717 GAGGGCTGGAATTCCCAGGAGGG + Intergenic
1092268411 12:7001599-7001621 GAGGGCTGGGGCTGACAGGTAGG + Intronic
1092469921 12:8768294-8768316 GAGGGGTGGAAGTCAACGGTGGG + Intronic
1092547850 12:9467179-9467201 GAGGGCAGGCCCTCACAGGTGGG + Intergenic
1092716839 12:11397836-11397858 GAGGGCTGCCACTCACATATAGG - Intronic
1093203506 12:16219066-16219088 CAGTGCTGGAACTGAGAGGTGGG + Intronic
1094505135 12:31055183-31055205 GAGGGCAGGCCCTCACAGGTAGG - Intergenic
1096140527 12:49239021-49239043 GAGGGCTGGAACTTCCAGGGAGG - Intronic
1096529733 12:52235017-52235039 GAGGGCTGGAAGCCCCAGGCAGG + Intronic
1102988683 12:117299104-117299126 GAGAGGTGGTACCCACAGGTGGG - Intronic
1103472315 12:121191750-121191772 GAGCTCTGGAAGTCACATGTGGG - Intergenic
1107078189 13:36346220-36346242 GAGGTCTGGAAGGCGCAGGTGGG - Intronic
1109520630 13:63505553-63505575 GAGGGATGGAAGTCAGAGGCGGG + Intergenic
1110846144 13:80192461-80192483 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
1111522562 13:89425405-89425427 GAGGGCTTGAAGCCAGAGGTTGG + Intergenic
1114497550 14:23143430-23143452 GAGGGCTGGAAGCCAGAAGTAGG + Intronic
1118138746 14:63056597-63056619 TAGGGCTGGAGCTGGCAGGTGGG + Intronic
1119089940 14:71772184-71772206 GAGGGATGGAAGTCAGAGGCGGG + Intergenic
1119732943 14:76962631-76962653 GCTGGCTGGAGCTCACAGGGTGG + Intergenic
1120397385 14:83985613-83985635 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
1121423546 14:93832431-93832453 GAGGCCTGGAATGCACGGGTGGG + Intergenic
1121650139 14:95552142-95552164 GAGGGGTGGGGCTTACAGGTAGG + Intergenic
1122124579 14:99572146-99572168 GAGGGCTCAAATTCACAGGGTGG + Intronic
1122622953 14:103070215-103070237 CACGGCTGGGCCTCACAGGTGGG + Intergenic
1127087403 15:55437346-55437368 GAAGCCTGGAACTGACAGGTTGG - Intronic
1128078851 15:64844337-64844359 GAGGCCAGGAGCACACAGGTGGG - Intronic
1128137652 15:65275910-65275932 AAGGGCTGTGACTCACAGGTGGG - Intronic
1128363109 15:66976451-66976473 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
1128521868 15:68380662-68380684 AAGGGCTGGGGCTCACAGGGAGG + Intronic
1129924265 15:79348909-79348931 GAAGCCTAGAACTCCCAGGTGGG + Intronic
1130011412 15:80155517-80155539 TAGGGCTGGACCTTACAGATTGG - Intronic
1130394934 15:83493646-83493668 CAGGGCAGGAGCTCACAGGATGG - Intronic
1130966111 15:88699245-88699267 GAGGCCTGGAACACCCAGGCTGG - Intergenic
1131058306 15:89389620-89389642 AAGTGCTGGGACTCAGAGGTGGG - Intergenic
1133013885 16:2930040-2930062 GAGCGCTGGAACCCACGGGGTGG - Intronic
1134874594 16:17686353-17686375 GAGAGCTGGAACCCACTGATTGG - Intergenic
1135040220 16:19112718-19112740 AAGGGGTGGAACTCCCAGGAGGG - Intergenic
1136494050 16:30630817-30630839 GAGGGCTGCAAAGTACAGGTAGG - Intergenic
1136695812 16:32080638-32080660 GTGTGCTGGAAATAACAGGTTGG - Intergenic
1136796308 16:33023891-33023913 GTGTGCTGGAAATAACAGGTTGG - Intergenic
1136873609 16:33830506-33830528 GTGTGCTGGAAATAACAGGTTGG + Intergenic
1137559588 16:49494128-49494150 GAAGGCTGGAACCCACACCTGGG + Intronic
1138194097 16:55039998-55040020 GTGGGGTGGAAGTCACAGATAGG - Intergenic
1139353681 16:66353983-66354005 AGGGGCTGGGATTCACAGGTGGG + Intergenic
1139876836 16:70152936-70152958 GAGAGCTGGGCCTCACAGCTTGG + Intronic
1140998391 16:80283902-80283924 GTGGCCTTGACCTCACAGGTTGG + Intergenic
1141573950 16:84952307-84952329 GAGGGCTGGGGCTCACAAGCCGG - Intergenic
1142233017 16:88908615-88908637 GAGTTCTGGAACTCCCAGGCTGG - Intronic
1203098565 16_KI270728v1_random:1285550-1285572 GTGTGCTGGAAATAACAGGTTGG - Intergenic
1143615357 17:8046279-8046301 GAGGCCTGGCGCTCAGAGGTGGG + Intronic
1143975802 17:10828727-10828749 GAGGGTTGGAATGAACAGGTTGG - Intronic
1144046235 17:11457064-11457086 GAGAGCTGGAACTGACAAGGGGG - Intronic
1144638063 17:16923582-16923604 TGGGCCTGGGACTCACAGGTGGG + Intergenic
1144704085 17:17356031-17356053 GCTGGCTTGTACTCACAGGTCGG + Intergenic
1146291288 17:31609270-31609292 GTAGTCTGGAACTCAGAGGTTGG + Intergenic
1147758416 17:42782647-42782669 GAGGGTTGGAGCCCACAGATGGG - Intronic
1147905229 17:43818196-43818218 AAGGCCTGGATCCCACAGGTGGG + Intronic
1148936135 17:51165963-51165985 GAAGGCTGGATTTCAGAGGTAGG + Intronic
1150459719 17:65339150-65339172 GATGTCTGCAACTAACAGGTTGG + Intergenic
1151866587 17:76807226-76807248 GAGAGCTGGAACCCACAGGGGGG + Intergenic
1154094033 18:11393606-11393628 GAGGGCAGGAATTCACAGGCAGG + Intergenic
1155715341 18:28935766-28935788 GATGGCTGGGTCTCACAGGGTGG - Intergenic
1157219358 18:45815053-45815075 AAGGGCTGGAGCTTACAGTTGGG + Intergenic
1157689666 18:49671009-49671031 GAGGGTGGGGCCTCACAGGTGGG + Intergenic
1158436457 18:57438032-57438054 GAGGGCTGTACCTCGCAGCTTGG - Intronic
1159058063 18:63486257-63486279 GAAGGCTGGGATTCACAGGCAGG + Intronic
1160515584 18:79477750-79477772 GGGGGCTGGAAGTCCGAGGTTGG + Intronic
1161065452 19:2235396-2235418 CCGGGCTGGAAATCCCAGGTGGG - Intronic
1162761956 19:12893698-12893720 GAGGTCTGGAACTCAAGGGTGGG + Intronic
1163636466 19:18439094-18439116 GTGGGTGGGAACTCACAGGCAGG + Intergenic
1164286487 19:23821852-23821874 GAGGGCTGCCGCTAACAGGTTGG + Intronic
1164289996 19:23858946-23858968 GAGGGCTGGAAGTCCCACTTGGG + Intergenic
1164700878 19:30283286-30283308 GTGGGCTGGAGATCACAGGCTGG + Intronic
1165170362 19:33887906-33887928 GAGGGCTGGAATTCAAAAGAGGG - Intergenic
1165791989 19:38498180-38498202 GAGGGCAGGAGGTGACAGGTGGG + Intronic
1167047435 19:47058650-47058672 GAGGGCTGGAAGCCTCAGGATGG - Intergenic
1167498232 19:49831376-49831398 GAGGGCTGGGGCTCCCAGCTGGG - Exonic
1168318892 19:55497021-55497043 CAGTGCTGGAATTAACAGGTGGG + Intronic
924973619 2:153869-153891 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
925046911 2:779120-779142 CAGGGCTGGAGCTCACGGCTGGG + Intergenic
925646710 2:6044052-6044074 GAGGGCCTGAACACACTGGTGGG - Intergenic
927492577 2:23530309-23530331 GCGTGATGGAACTGACAGGTTGG - Intronic
927864078 2:26577622-26577644 GAGGGCAGGCACTCACAGGACGG - Exonic
928341560 2:30447387-30447409 GGAGGCTGGAACTATCAGGTGGG + Exonic
928671904 2:33610999-33611021 GAGGGGTGGAAGTCAATGGTGGG + Intergenic
929406483 2:41648647-41648669 GCAGGCTGGAACTCTCAGGCAGG + Intergenic
929564637 2:42976707-42976729 GAGGGCTGGAGCGCTCAGGAGGG + Intergenic
931669712 2:64636386-64636408 GAGGGCTGGAGGTGACAGTTTGG + Exonic
932581681 2:72996230-72996252 GGGTGCTGGAGCTCACAGGGAGG + Intronic
936263271 2:110980138-110980160 GAGGGCTGTAACTCTCAGAGGGG - Intronic
939134084 2:138273487-138273509 GAGGGATGGAAATCAGCGGTGGG + Intergenic
942207793 2:173639180-173639202 GAGGGCAGGAAATCAGAGGCAGG + Intergenic
942831226 2:180238946-180238968 GAGGGGTGGAAGTCAATGGTGGG - Intergenic
946115586 2:217459186-217459208 GAGGGCTGAAACTCAAATATAGG + Intronic
946903459 2:224394286-224394308 GAGGGCTGGAACTCAGGAGGGGG - Intronic
947533262 2:230925924-230925946 GAGGGCTGAGACTCACCCGTGGG + Intronic
948999884 2:241607190-241607212 CAGGCCTGGAACTCAGAGGTGGG + Intronic
1169892363 20:10466755-10466777 GAGGGCTGGAATTTAGGGGTGGG + Intronic
1172020261 20:31908886-31908908 GAGGACTGGAGGTCACAGGCTGG + Intronic
1172095493 20:32458126-32458148 TAGGCCTGGCTCTCACAGGTGGG - Intronic
1172293693 20:33793265-33793287 CAGGGCTGGAACTCAGAGCCAGG + Intergenic
1172777311 20:37415157-37415179 GAGGGCTGGAACTCAGGGGATGG - Intergenic
1173377747 20:42504600-42504622 ATAGGCTGGAAGTCACAGGTGGG - Intronic
1175264134 20:57692408-57692430 GGTGGCAGGAACTCACAGGGCGG + Intronic
1175276030 20:57771352-57771374 GAGGGCTGGAGCTCGGAGGAGGG + Intergenic
1175709799 20:61210371-61210393 GGGTGCTGGAGCTCACAGATGGG - Intergenic
1176084303 20:63289100-63289122 GAGGGCTGGTGCCCACAGGGAGG - Exonic
1176170802 20:63695600-63695622 CAGCGCTGGAAGTCACAGGCAGG - Exonic
1176348965 21:5774693-5774715 GAGGGCTCGAACACACCTGTAGG - Intergenic
1176355779 21:5895277-5895299 GAGGGCTCGAACACACCTGTAGG - Intergenic
1176543286 21:8172763-8172785 GAGGGCTCGAACACACCTGTAGG - Intergenic
1176562237 21:8355808-8355830 GAGGGCTCGAACACACCTGTAGG - Intergenic
1178115190 21:29409712-29409734 AACAGCTGGAACTCACAGGCAGG + Intronic
1180961418 22:19764034-19764056 GAGGGTTCAATCTCACAGGTGGG + Intronic
1182814283 22:33145664-33145686 GAAGGCTGGAACTAACAGCATGG + Intergenic
1183907054 22:41049507-41049529 GAGGGATGCAAGTCACAGGATGG + Intergenic
1184165890 22:42727506-42727528 GAGAGCTGGCAGTCACAGGGTGG - Intergenic
1184426263 22:44410857-44410879 GAGAGCTGGAAATCTCAGCTGGG - Intergenic
1185217566 22:49610297-49610319 GATGGCTGGAAGTCTGAGGTGGG - Intronic
1203248155 22_KI270733v1_random:88982-89004 GAGGGCTCGAACACACCTGTAGG - Intergenic
949567536 3:5258774-5258796 GCTGCCTGGAACTCACTGGTGGG - Intergenic
950686121 3:14619758-14619780 GTGGGGTGGAAGTCAGAGGTTGG + Intergenic
951898806 3:27636594-27636616 AAGGGCTGGAACTCACCTGAAGG + Intergenic
952922695 3:38296896-38296918 GAGGGGTGGAAGTCAGCGGTGGG + Intronic
952971210 3:38651318-38651340 GACGGATGGACCACACAGGTCGG + Intergenic
953515825 3:43591220-43591242 GAGGGATGGAAGTCAATGGTGGG - Intronic
953870217 3:46619704-46619726 GAGGGCTGGACCTCAGAGTGCGG - Intronic
954346483 3:50004064-50004086 GAGGGCTAGTACTCACAACTGGG - Intronic
956564244 3:70617515-70617537 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
958030714 3:88105894-88105916 GAGGGCCTGCCCTCACAGGTGGG + Intronic
958981645 3:100727172-100727194 CTGGCCTGGCACTCACAGGTAGG - Intronic
962464814 3:135648530-135648552 GAGGGCTGGAAAACAAAGTTGGG - Intergenic
963072116 3:141312922-141312944 GAGCTGTGGAACTCACATGTAGG - Intergenic
965342132 3:167503677-167503699 GAGGGATGGAAGTCAGCGGTGGG + Intronic
966329483 3:178794755-178794777 GAGGGCTGGAACTCACAGGTGGG + Intronic
966877540 3:184331756-184331778 GAGGGCTCGAACTAACGTGTTGG - Exonic
967085234 3:186088788-186088810 GAGGGCTTTAAGTCACAGGAGGG + Intronic
968094205 3:195916592-195916614 GAGAGCTGGAACTGAGAGTTTGG - Intergenic
968550821 4:1222682-1222704 GGGGGTTGGAACACCCAGGTCGG - Intronic
969644663 4:8420775-8420797 GAGGGGTGGAAGTCAGTGGTGGG - Intronic
974812556 4:66963855-66963877 GAGGGCTGTTACCCACATGTAGG - Intergenic
975122869 4:70748249-70748271 GAGAACTGGAAAACACAGGTAGG - Intronic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
978587026 4:110284270-110284292 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
978909021 4:114044530-114044552 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
979910832 4:126363704-126363726 GAGGGATGGAAGTCAGTGGTAGG - Intergenic
980390759 4:132143232-132143254 GAGGGCTGAACCTCCCAGCTTGG + Intergenic
981740759 4:147999466-147999488 GAGGGATGGAAGTCAGTGGTGGG - Intronic
986427835 5:7652127-7652149 CAGGGCTGGAACTCTCAGTAGGG - Intronic
990562193 5:56994305-56994327 TAGGGCTTGAATTCCCAGGTGGG + Intergenic
991157760 5:63458921-63458943 CATGGCTGGAAATCACAGTTTGG - Intergenic
993448380 5:88043039-88043061 GAAGGCTGGAACTCATAGGCAGG - Intergenic
995048293 5:107673062-107673084 GAGGGCTGAAAGGCACAGGAGGG - Intergenic
995466154 5:112451125-112451147 GAGGGATGGAAGTCAGCGGTGGG - Intergenic
997720713 5:136076655-136076677 GAGGGATGGAAAAAACAGGTTGG + Intergenic
1000222054 5:159223712-159223734 GAGGGCTGGAACACAAATTTGGG - Intergenic
1001597155 5:172905666-172905688 GAGGGGTGGAAGTCAGCGGTGGG + Intronic
1001627499 5:173148504-173148526 CAGGGCTGGAACTCAGGAGTTGG + Intronic
1002173262 5:177386815-177386837 GCAGGCGGGAACTCTCAGGTGGG + Intronic
1002375840 5:178788664-178788686 CAGGGCTGTGACTCCCAGGTTGG - Intergenic
1003468132 6:6401114-6401136 CAGGTCTGGAAAGCACAGGTAGG + Intergenic
1004007313 6:11649069-11649091 GAGGGGTGGAAGTCAGAGGCGGG - Intergenic
1004134927 6:12957278-12957300 GAAGTCTGGAACTCACAGCCTGG - Intronic
1004409110 6:15363867-15363889 GAGGGCTGGAGGACACAGGAAGG + Intronic
1004410896 6:15380564-15380586 GCTGGCTGGAACTCACTGGACGG + Intronic
1006332005 6:33398331-33398353 GAGGGATGGAACTCTTGGGTGGG - Exonic
1007243127 6:40441461-40441483 GAGGGCTGGATTTCACCAGTGGG + Intronic
1009702461 6:67201746-67201768 GAGGGGTGGAAGTCAGCGGTGGG - Intergenic
1009850508 6:69192062-69192084 GAGGGATGGAACTAATAGGATGG + Intronic
1010085564 6:71913739-71913761 AAGGCCTGGAACTCACAGATTGG - Intronic
1011190320 6:84720722-84720744 GAGGGGTGGAAGTCAACGGTGGG + Intronic
1012735046 6:102928298-102928320 GGGGGCGTGCACTCACAGGTGGG - Intergenic
1015632767 6:135247977-135247999 GAGGGGTGGAAGTCAGTGGTGGG - Intergenic
1016334497 6:142989956-142989978 GCAGGCTGGAACTCTCAGGAAGG - Intergenic
1016444924 6:144121391-144121413 GAGGGGTGGAAGTCAGCGGTGGG + Intergenic
1017500201 6:155017056-155017078 CAGAGCAGGAACTCACAGGCAGG + Intronic
1019206518 6:170366283-170366305 GAGAGCTGGGACTCATGGGTGGG + Intronic
1019767072 7:2859367-2859389 GAGGGCTCTACCCCACAGGTGGG - Intergenic
1019943270 7:4307890-4307912 GAGGGCTCCAGCCCACAGGTGGG - Intergenic
1020906209 7:14067243-14067265 GAGGGATGGAAGTCAGAGGCGGG - Intergenic
1021761484 7:23906344-23906366 GAGGGCTGCCACTGACAAGTAGG + Intergenic
1023118626 7:36886993-36887015 GAGAGCTGGCACTCACTGTTTGG - Intronic
1029704714 7:102270209-102270231 GGAGGCTGGAACACGCAGGTGGG - Intronic
1030431257 7:109452210-109452232 GAGGGGTGGAAGTCAGAGGTGGG - Intergenic
1032653845 7:133906717-133906739 GAGGGATGGAAGTCAGCGGTGGG - Intronic
1034527069 7:151671795-151671817 GAGGGCTGAAACTTACAAGTGGG + Intronic
1034707077 7:153155177-153155199 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
1037379957 8:18274629-18274651 GAGGGGTGGAAGTCAACGGTGGG + Intergenic
1037570605 8:20154867-20154889 GAGGGGTGGAAGTCAATGGTGGG - Intronic
1039436168 8:37560840-37560862 CTGGGCTGGAACTCAGAGGTAGG - Intergenic
1041363305 8:57074211-57074233 GAGGGAGGGAACTTAGAGGTTGG - Intergenic
1042647540 8:71004248-71004270 GAGGGCTGGGAATGACAGGCAGG + Intergenic
1043138882 8:76562925-76562947 GAGGGCTGTAACTCAGTGCTGGG - Intergenic
1044904947 8:96990748-96990770 GAGGGATGGAAACCACAGGATGG + Intronic
1045405402 8:101861433-101861455 CATGGGTGGAACACACAGGTAGG + Intronic
1046244468 8:111540358-111540380 GAGGTCTGGAACTGAGAGGCTGG - Intergenic
1047599744 8:126413939-126413961 GAGGGGTGGAAGTCAGTGGTGGG + Intergenic
1049379868 8:142306636-142306658 GGGGGCTGCTACTCACAGGCCGG - Intronic
1049717656 8:144100545-144100567 GTGGGCTGGGCCTCACAGGGCGG - Intronic
1050593501 9:7183574-7183596 GAGGGATGGAAGTCAGTGGTGGG - Intergenic
1053439223 9:38102080-38102102 AAGGGCTGGCACTCAGGGGTTGG - Intergenic
1055049595 9:71965005-71965027 GAGGGATGGAAGTCAGTGGTGGG + Intronic
1055710171 9:79051977-79051999 GAGGGCAGGAGCCCACAGGTAGG + Intergenic
1056449704 9:86705006-86705028 GAGGGAAGGAAGTCACAGGGAGG - Intergenic
1056705012 9:88944250-88944272 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1058231954 9:102436794-102436816 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1060053163 9:120391402-120391424 CAGAGCTGGGACTCACATGTGGG + Intronic
1060495422 9:124114998-124115020 GAGGGCTGGAACCCACAACTGGG - Intergenic
1061545848 9:131303874-131303896 CAGGGCTGGAGCTCACAGCTGGG + Intronic
1061964860 9:134007466-134007488 GAAGTCTGGAACTAAGAGGTCGG - Intergenic
1062599546 9:137313692-137313714 CAGGGTTGGAAATCCCAGGTTGG - Intronic
1203464557 Un_GL000220v1:72233-72255 GAGGGCTCGAACACACCTGTAGG - Intergenic
1185560913 X:1060105-1060127 GAGGGGTGGAACTCAAAGGTGGG - Intergenic
1189152095 X:38719480-38719502 GAGGGTTGGAAGTCAATGGTGGG + Intergenic
1189674743 X:43450460-43450482 GAAGGCTGGAACTCACACATAGG - Intergenic
1189954275 X:46261970-46261992 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1190368106 X:49716703-49716725 GAGGGGTGGAAGTCAGTGGTGGG - Intergenic
1192803107 X:74485853-74485875 GAGGGGTGGAAGTCAGAAGTGGG + Intronic
1193274570 X:79570597-79570619 GAGGGCTGGAGCTCCCAGCTGGG + Intergenic
1195902496 X:109813675-109813697 AAGGACTGGAATTCACAGGGGGG + Intergenic
1197545326 X:127816573-127816595 GAGGGATGGAAGTCAGCGGTGGG + Intergenic
1198506344 X:137304732-137304754 GAGAGGAAGAACTCACAGGTGGG - Intergenic
1198975824 X:142334062-142334084 GTGTGGTGCAACTCACAGGTTGG - Intergenic
1200212138 X:154351455-154351477 GAGGCCTGGAACCCAGAGCTGGG + Intronic
1200762685 Y:7054615-7054637 GAGGGATGGAAGTCAGCGGTAGG - Intronic
1201147729 Y:11074093-11074115 GAGGGCAGAAACTCAGAGGCAGG - Intergenic
1201329232 Y:12800034-12800056 GAGGGGTGGAAGTCAATGGTGGG - Intronic
1202033110 Y:20599098-20599120 GATGACTGGAAATGACAGGTGGG + Intergenic