ID: 966332492

View in Genome Browser
Species Human (GRCh38)
Location 3:178829973-178829995
Sequence CCACCGTGTAACCACCTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966332492 Original CRISPR CCACCGTGTAACCACCTTAA GGG Intronic
907310383 1:53535629-53535651 CCACCTTGTAATCACCTTCCAGG + Intronic
914429638 1:147609199-147609221 CAACTGTTTAACCACCTTTAAGG - Intronic
923447884 1:234089435-234089457 CCACCATCCAACCACCTGAATGG - Intronic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1066428617 10:35332064-35332086 CCACAGTGTAACCAGCTACAGGG - Intronic
1079388346 11:20000224-20000246 CCACCGTGTAACAACATCAGAGG + Intronic
1088133099 11:106519817-106519839 CCACCGTGTGACCATCCTACGGG + Intergenic
1094332288 12:29307650-29307672 GCATCGTCTAACCACCTAAAAGG - Exonic
1094809332 12:34122599-34122621 ACACGCTGTAATCACCTTAATGG - Intergenic
1095899419 12:47312451-47312473 CCGCCTTATAACCTCCTTAAGGG + Intergenic
1097266806 12:57750751-57750773 CCAGAGTGTAACAACCTAAAGGG + Exonic
1097780323 12:63695946-63695968 CCACCTTCCAACCACCTTTAGGG + Intergenic
1106030418 13:25997104-25997126 CCACCGTGCCCCCACCTTATAGG + Intronic
1106526678 13:30546836-30546858 CTACCGTGAATCCACCTTTAGGG + Intronic
1110198617 13:72820981-72821003 CCAGAGTGTAAACATCTTAAGGG - Intronic
1110226204 13:73122273-73122295 CCACCTTGTCACCACCTCAGGGG - Intergenic
1112114099 13:96334017-96334039 CCACAGTGTACCCACCCTACAGG - Intronic
1114521887 14:23344686-23344708 CCACCCTGCAACCATCTGAATGG + Intergenic
1122286921 14:100657817-100657839 ACACCGAGTGTCCACCTTAAAGG - Intergenic
1131924829 15:97371113-97371135 CCACCAAGGAACAACCTTAATGG - Intergenic
1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG + Intronic
1133537749 16:6718506-6718528 CCAAAGTGAAACCACCTTTAAGG + Intronic
1151744145 17:76002503-76002525 CCACAGTGTCACCACCTGCAGGG - Exonic
1151990270 17:77570185-77570207 CCACTGTGGAACCAGCCTAAGGG - Intergenic
1158517102 18:58139794-58139816 CCACCGTAGAACCCCCTAAAAGG + Intronic
1158682982 18:59585279-59585301 CCCCCATGTAATCACCTTCATGG + Intronic
1160962319 19:1728378-1728400 CAACTCCGTAACCACCTTAAAGG + Intergenic
1161886118 19:6997169-6997191 CCACCATGGCACCACCTTAGTGG - Intergenic
930058076 2:47267299-47267321 CCACGTTGTAAGCACCTTAAGGG + Intergenic
930311209 2:49742286-49742308 CCACTGTTTAAACACATTAATGG + Intergenic
937253047 2:120536119-120536141 CCACCGTGCAGCCCCCTTAAAGG + Intergenic
944174170 2:196811365-196811387 CTACTGTGTAACCACCTAACTGG - Intergenic
945050090 2:205815524-205815546 CCACCATGGAAACACCTTCATGG - Intergenic
1170446597 20:16434342-16434364 GGCCCGTGTAACCACCGTAATGG + Intronic
1178704891 21:34864902-34864924 CCACTGTGTTTCCACCTTCATGG - Intronic
951754984 3:26081063-26081085 CCACATTGTAACCCCCTTAGAGG - Intergenic
953365372 3:42340225-42340247 CCACTGTCTAGCCACATTAAAGG + Intergenic
964651504 3:159016298-159016320 CCACTGGGTAACCACCTTCTCGG - Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
976171999 4:82313810-82313832 CCACCATGTAAGGACCTTGAAGG + Intergenic
980483206 4:133416668-133416690 ATACCGTGTAACTACCTGAATGG - Intergenic
999692008 5:154156276-154156298 CCACTGTGTACCCACCAGAATGG + Intronic
1006781037 6:36632483-36632505 CCAGCGTGTAATCACGTTCAGGG - Intergenic
1013980960 6:116128666-116128688 CCACTGTGTAAACACTTTAAGGG - Intronic
1015639676 6:135317629-135317651 CCAGCCTGTAAGCAACTTAAGGG + Intronic
1026166109 7:67911205-67911227 CCACCTAATAACCACCTTGAGGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038497039 8:28010888-28010910 ACACCCTGTAACCACCTGATGGG - Intergenic
1038724438 8:30068003-30068025 CCACCAGATAACCACCATAATGG - Intronic
1040997583 8:53417691-53417713 CCAAAATGTAACCACCTGAATGG + Intergenic
1046126781 8:109920194-109920216 CCAGAGTGTAAGCTCCTTAAAGG - Intergenic
1049855738 8:144860702-144860724 TCTCCGTGTAACCAACTCAAGGG - Intergenic
1052177055 9:25474684-25474706 CCACATTGAAACCACATTAAAGG + Intergenic
1053167875 9:35857264-35857286 CCACCGTGTGAGCTCCTTCAGGG - Intergenic
1186034829 X:5411176-5411198 TCACCTTGTAACCACCTGAGAGG + Intergenic
1190063744 X:47226622-47226644 CCACAGTGTCACCACCTCATTGG - Exonic
1194670839 X:96730699-96730721 CTAGAGTGTAACCTCCTTAAAGG + Intronic
1195474995 X:105275481-105275503 CCATCCTGTAAGCTCCTTAAGGG + Intronic