ID: 966334798

View in Genome Browser
Species Human (GRCh38)
Location 3:178856139-178856161
Sequence GCCCATTGGGTGATGGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966334798_966334803 -10 Left 966334798 3:178856139-178856161 CCATTCCCCATCACCCAATGGGC No data
Right 966334803 3:178856152-178856174 CCCAATGGGCTCATAAAATGTGG No data
966334798_966334805 -1 Left 966334798 3:178856139-178856161 CCATTCCCCATCACCCAATGGGC No data
Right 966334805 3:178856161-178856183 CTCATAAAATGTGGTCACTGAGG No data
966334798_966334806 22 Left 966334798 3:178856139-178856161 CCATTCCCCATCACCCAATGGGC No data
Right 966334806 3:178856184-178856206 CAGAGATTAAAGATATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966334798 Original CRISPR GCCCATTGGGTGATGGGGAA TGG (reversed) Intergenic
No off target data available for this crispr