ID: 966336999

View in Genome Browser
Species Human (GRCh38)
Location 3:178879561-178879583
Sequence GAAGTGTTCAGGGAACACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966336999_966337004 -7 Left 966336999 3:178879561-178879583 CCCAAGTGTTCCCTGAACACTTC No data
Right 966337004 3:178879577-178879599 ACACTTCTGTAGCCTTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966336999 Original CRISPR GAAGTGTTCAGGGAACACTT GGG (reversed) Intergenic