ID: 966338085

View in Genome Browser
Species Human (GRCh38)
Location 3:178893301-178893323
Sequence GGGGATACACGGATGGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966338075_966338085 13 Left 966338075 3:178893265-178893287 CCGTGAAGGGTAGTGGGGCTGGG No data
Right 966338085 3:178893301-178893323 GGGGATACACGGATGGTTAATGG No data
966338070_966338085 20 Left 966338070 3:178893258-178893280 CCAGAGGCCGTGAAGGGTAGTGG No data
Right 966338085 3:178893301-178893323 GGGGATACACGGATGGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966338085 Original CRISPR GGGGATACACGGATGGTTAA TGG Intergenic
No off target data available for this crispr