ID: 966339405

View in Genome Browser
Species Human (GRCh38)
Location 3:178908570-178908592
Sequence GACCTACTGCGTGTGCAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966339405_966339407 10 Left 966339405 3:178908570-178908592 CCGGTCTGCACACGCAGTAGGTC No data
Right 966339407 3:178908603-178908625 ATACGCCCCTCTCTAACACCTGG No data
966339405_966339411 23 Left 966339405 3:178908570-178908592 CCGGTCTGCACACGCAGTAGGTC No data
Right 966339411 3:178908616-178908638 TAACACCTGGAGCCCTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966339405 Original CRISPR GACCTACTGCGTGTGCAGAC CGG (reversed) Intergenic
No off target data available for this crispr