ID: 966340841

View in Genome Browser
Species Human (GRCh38)
Location 3:178923807-178923829
Sequence TGGGCAGGACCTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966340831_966340841 -2 Left 966340831 3:178923786-178923808 CCCAATCCCATTTCTCCTCACTG No data
Right 966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG No data
966340835_966340841 -8 Left 966340835 3:178923792-178923814 CCCATTTCTCCTCACTGGGCAGG 0: 6
1: 38
2: 109
3: 248
4: 557
Right 966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG No data
966340837_966340841 -9 Left 966340837 3:178923793-178923815 CCATTTCTCCTCACTGGGCAGGA 0: 8
1: 57
2: 110
3: 224
4: 589
Right 966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG No data
966340832_966340841 -3 Left 966340832 3:178923787-178923809 CCAATCCCATTTCTCCTCACTGG No data
Right 966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966340841 Original CRISPR TGGGCAGGACCTCCCAAATG GGG Intergenic
No off target data available for this crispr