ID: 966346752

View in Genome Browser
Species Human (GRCh38)
Location 3:178989362-178989384
Sequence TTCCTGCTGCCTTGTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 7180
Summary {0: 212, 1: 673, 2: 1611, 3: 2101, 4: 2583}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966346752_966346754 -6 Left 966346752 3:178989362-178989384 CCTTCTTCACAAGGCAGCAGGAA 0: 212
1: 673
2: 1611
3: 2101
4: 2583
Right 966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG No data
966346752_966346755 -5 Left 966346752 3:178989362-178989384 CCTTCTTCACAAGGCAGCAGGAA 0: 212
1: 673
2: 1611
3: 2101
4: 2583
Right 966346755 3:178989380-178989402 AGGAAAGACAGAGAGAGCAGGGG No data
966346752_966346753 -7 Left 966346752 3:178989362-178989384 CCTTCTTCACAAGGCAGCAGGAA 0: 212
1: 673
2: 1611
3: 2101
4: 2583
Right 966346753 3:178989378-178989400 GCAGGAAAGACAGAGAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966346752 Original CRISPR TTCCTGCTGCCTTGTGAAGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr