ID: 966346754 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:178989379-178989401 |
| Sequence | CAGGAAAGACAGAGAGAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 966346752_966346754 | -6 | Left | 966346752 | 3:178989362-178989384 | CCTTCTTCACAAGGCAGCAGGAA | 0: 212 1: 673 2: 1611 3: 2101 4: 2583 |
||
| Right | 966346754 | 3:178989379-178989401 | CAGGAAAGACAGAGAGAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 966346754 | Original CRISPR | CAGGAAAGACAGAGAGAGCA GGG | Intergenic | ||
| No off target data available for this crispr | |||||