ID: 966346754

View in Genome Browser
Species Human (GRCh38)
Location 3:178989379-178989401
Sequence CAGGAAAGACAGAGAGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966346752_966346754 -6 Left 966346752 3:178989362-178989384 CCTTCTTCACAAGGCAGCAGGAA 0: 212
1: 673
2: 1611
3: 2101
4: 2583
Right 966346754 3:178989379-178989401 CAGGAAAGACAGAGAGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966346754 Original CRISPR CAGGAAAGACAGAGAGAGCA GGG Intergenic
No off target data available for this crispr