ID: 966353265

View in Genome Browser
Species Human (GRCh38)
Location 3:179054718-179054740
Sequence CGGCAAGCAGCAGTGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 4, 2: 70, 3: 139, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966353265_966353267 -5 Left 966353265 3:179054718-179054740 CCATCCAACACTGCTGCTTGCCG 0: 1
1: 4
2: 70
3: 139
4: 215
Right 966353267 3:179054736-179054758 TGCCGCCATCGCAGACCCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 53
966353265_966353276 24 Left 966353265 3:179054718-179054740 CCATCCAACACTGCTGCTTGCCG 0: 1
1: 4
2: 70
3: 139
4: 215
Right 966353276 3:179054765-179054787 CCATGCCTCCGGATCCAGCAGGG 0: 1
1: 22
2: 77
3: 138
4: 230
966353265_966353274 23 Left 966353265 3:179054718-179054740 CCATCCAACACTGCTGCTTGCCG 0: 1
1: 4
2: 70
3: 139
4: 215
Right 966353274 3:179054764-179054786 TCCATGCCTCCGGATCCAGCAGG 0: 1
1: 13
2: 78
3: 131
4: 220
966353265_966353272 13 Left 966353265 3:179054718-179054740 CCATCCAACACTGCTGCTTGCCG 0: 1
1: 4
2: 70
3: 139
4: 215
Right 966353272 3:179054754-179054776 GCCGGCGACTTCCATGCCTCCGG 0: 1
1: 0
2: 2
3: 24
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966353265 Original CRISPR CGGCAAGCAGCAGTGTTGGA TGG (reversed) Intronic
900090860 1:919845-919867 CTGCAGGCCGCAGTGTTGGCAGG + Intergenic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
903982588 1:27200323-27200345 CTGGAGGCAGCAGTGCTGGATGG - Intergenic
904445458 1:30570171-30570193 CGGTAAGCAGCTCTGTGGGATGG + Intergenic
906478501 1:46185590-46185612 TGGCAAGCAGCAGTGATTGGGGG + Exonic
907329484 1:53661763-53661785 CGGCAAGTAGCAGGGATGGTGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
910861566 1:91747376-91747398 CTGCAAGCAGCAGTGAAGGGTGG - Intronic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
914428748 1:147600656-147600678 TGGGATGCAGGAGTGTTGGAGGG + Intronic
915811942 1:158922409-158922431 CGCAAAGCAACAGTGTTGGCAGG + Intergenic
917076644 1:171213040-171213062 CTCCATGCAGCAGTGTTGGGAGG + Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919133616 1:193481531-193481553 CTGCAAGCAGCTCTGTTGGGAGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066537866 10:36411045-36411067 CCCAATGCAGCAGTGTTGGAAGG + Intergenic
1067839791 10:49666484-49666506 CAGGAAGCAGCAGGATTGGAGGG - Intergenic
1068749758 10:60578720-60578742 TGGAAAGCTGCTGTGTTGGATGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070604896 10:77891839-77891861 CAGCAAGCAGCAGAGCCGGATGG - Intronic
1070829751 10:79411093-79411115 CAGCAGGCAACAGTGATGGATGG + Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072220421 10:93323174-93323196 CTGCAAGAAGCACAGTTGGAAGG + Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073185426 10:101612712-101612734 CGGCACGCAGGTGTGATGGAGGG - Intronic
1073580325 10:104659907-104659929 AGGGAACCAGCAATGTTGGAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075322184 10:121500189-121500211 GGGCATGAAGCAGGGTTGGAAGG + Intronic
1075706526 10:124505411-124505433 CGGGAAGCAGCAGTGATCAAGGG - Intronic
1075707379 10:124509803-124509825 CGGGAAGCAGCAGGGCTGGGTGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076495731 10:130896382-130896404 CAGCAAGGAGCCGTCTTGGAAGG + Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080647866 11:34199928-34199950 CGGCAGGCAGTAGTCCTGGAAGG - Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081274184 11:41126620-41126642 AGGCCAGAATCAGTGTTGGAAGG - Intronic
1081914029 11:46719517-46719539 GGGCAAGGGGCAGTGTAGGAGGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1087901304 11:103644892-103644914 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1092208399 12:6630863-6630885 CGGGAAGCAGAAGTGTGGGATGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094793344 12:33940183-33940205 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095104619 12:38216935-38216957 TGGCAAGCAGCAGTGAAAGAAGG + Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096352553 12:50912232-50912254 TGGAAAACAGCAGTGATGGACGG + Intergenic
1096472252 12:51887170-51887192 CGGCAGGCAGTAGTGAGGGAGGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103630807 12:122259049-122259071 CTCCCAGCAGCAGTGTGGGAGGG - Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104087772 12:125492329-125492351 TGGCATGCAGCAGTGTTTGGAGG - Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG + Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108334185 13:49421835-49421857 CCCCCAGCAGTAGTGTTGGAGGG + Intronic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109198513 13:59405891-59405913 CCCAAAGCAGCAGTGTTGGAAGG + Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114390319 14:22301150-22301172 AGGCAAAAAGCAATGTTGGATGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115788600 14:36854874-36854896 CAGAAAGCTGCAGTGTAGGAGGG + Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120502540 14:85314484-85314506 CGGCAAGTAATAGTGTTGTAAGG + Intergenic
1122371761 14:101233053-101233075 CGGGAAGGAGCAGTGTGGGGAGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1202894798 14_GL000194v1_random:744-766 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124149893 15:27167969-27167991 AGGCGAGCAGAAGTGATGGAGGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128892366 15:71342677-71342699 CTCCAGGCAGCCGTGTTGGAGGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1139420389 16:66845904-66845926 CGGCATGCAGCAGTGTTCACAGG + Intronic
1140861261 16:79020236-79020258 CTGCAAGGCGCAGTGCTGGATGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1143309380 17:5975873-5975895 CAGAGAGCAGCTGTGTTGGAGGG - Intronic
1144674002 17:17150138-17150160 CGGCAGGCAGCCGACTTGGATGG + Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153610135 18:6876451-6876473 AGGCAAGCAGCAGTTTTTGATGG - Intronic
1153610138 18:6876509-6876531 AGGCAAGCAGCAGTTTTTGATGG - Intronic
1153775840 18:8452763-8452785 AGGGAAGCAGCTTTGTTGGATGG - Intergenic
1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160076976 18:75686723-75686745 CTGAAAGAAGCAGTGTTGAAGGG + Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160293952 18:77620945-77620967 CTGCAAGCTGCAGTGAGGGATGG + Intergenic
1161986151 19:7655604-7655626 GGGCCAGCAGCAGTGGTGGTGGG + Intergenic
1163302530 19:16457028-16457050 CTGCAAGGAGCAGGGCTGGAAGG + Intronic
1163686353 19:18714034-18714056 CCGGAAGCAGCAGGGTGGGAGGG + Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925302791 2:2828901-2828923 CTGTAGGCAGCAGTGCTGGAAGG - Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
927927656 2:27024837-27024859 TGGGAAGCAGCAGCGTTGGGAGG + Intronic
928275843 2:29899349-29899371 CTGCAAGCAGCTGTGTGTGAAGG + Intronic
928348185 2:30519878-30519900 TGGCATTCAGCAGTGGTGGATGG - Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930631150 2:53756757-53756779 CGGTGATCAGCAGTGGTGGACGG - Intronic
930687064 2:54321158-54321180 GGGCAAGCAACAGTTTTGCAGGG + Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
934665032 2:96163950-96163972 CGGGGCCCAGCAGTGTTGGAGGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935760729 2:106318266-106318288 AGGGAAGCAGCAGGGTTTGAGGG - Intergenic
936050450 2:109218661-109218683 CGGCCAGCAGGAGTGAGGGAGGG + Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939611908 2:144321139-144321161 GGCCAACTAGCAGTGTTGGAGGG - Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941395565 2:164968911-164968933 TGGCGATCAGCAGTGGTGGACGG + Intergenic
942545912 2:177063467-177063489 CTGCCAGCAGCACTGTTGGCTGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
1168891715 20:1299334-1299356 CCTCAAGGAGCAGAGTTGGATGG + Intronic
1168896865 20:1329556-1329578 CTAGAAGCAGCAGTGATGGATGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173691770 20:44966473-44966495 CGGAAAGCGGAAGTGTGGGAGGG + Exonic
1173748968 20:45461268-45461290 TGGCAAACATCAGTGTTTGAGGG + Intergenic
1176614497 21:9016731-9016753 TGGCAGGCACCAGTGCTGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177959954 21:27651271-27651293 GGCCAAGCTGCAGTGTTGAAAGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1180875437 22:19173008-19173030 TGGCACGCAGCAGTGTGTGAGGG + Intergenic
1184372399 22:44090758-44090780 CTGCAGGCAGCTGTGCTGGACGG + Intronic
1184420768 22:44381748-44381770 TGGCAAGAAGCAGTGTGGGGAGG + Intergenic
1185309154 22:50144139-50144161 AGGTCAGCAGCACTGTTGGAGGG - Exonic
949212186 3:1516230-1516252 AGGCAACCAGCAGTCCTGGAGGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950434087 3:12968047-12968069 CGGGAGGCGCCAGTGTTGGAGGG - Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951591925 3:24275670-24275692 CGGCAAAAACCAGAGTTGGATGG - Intronic
952240698 3:31529068-31529090 GGACAAGCAGCAGATTTGGAGGG - Intergenic
952753226 3:36842621-36842643 CGCCAAGCACCAGTGCTGGAAGG - Exonic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
952941907 3:38452158-38452180 AAGCAAGAAGCAGTGTTGTATGG - Intergenic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953787333 3:45921143-45921165 CAGAACTCAGCAGTGTTGGAGGG - Exonic
954548837 3:51463169-51463191 CTGCAAGCTGCAGTGTTTAAAGG + Exonic
954897848 3:53992184-53992206 AGGTAAGCAGAAGTGTTGCATGG - Intergenic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960474253 3:118104812-118104834 AAGCAAGCTGCAATGTTGGAGGG - Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963255679 3:143142484-143142506 CGGCGTTCAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965811000 3:172591896-172591918 TGACAAGCAGCAGGGGTGGATGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
968901570 4:3434568-3434590 CGGGACACAGCAGTGCTGGAGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969797480 4:9537261-9537283 GCGCAAGCAGCACTTTTGGAGGG - Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974190486 4:58496555-58496577 TGGCGATCAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975649056 4:76573872-76573894 CGGCAACCAGCAGACTTGCAAGG - Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977342088 4:95771734-95771756 TGACAATCAGCAGTGGTGGATGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979469621 4:121079264-121079286 AAGCTAGCAGCAGTGTTGGGAGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988756227 5:34253978-34254000 CAGAAAGAAGCAGTGTTTGATGG + Intergenic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991744423 5:69719460-69719482 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991753281 5:69835773-69835795 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991795995 5:70299184-70299206 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991802898 5:70392500-70392522 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991823804 5:70594774-70594796 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
991832602 5:70710892-70710914 CAGTAAGAAGCAGTGTTTGATGG - Intergenic
991888373 5:71298744-71298766 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
992000186 5:72428689-72428711 CAGGAAGCAGCAGAGTTGAAGGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993622826 5:90188273-90188295 CGGCGTTCAGCAGTGGTGGACGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996939816 5:128990943-128990965 CGGAGATCAGCAGTGGTGGACGG + Intronic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
999653772 5:153793313-153793335 TGGCAAGGAGCACTGATGGAAGG - Intronic
1001126544 5:169024626-169024648 AGGCGAGCAGCAGTGTTTGTCGG + Intronic
1001796811 5:174509265-174509287 ATGCAAGCAGAAGTGTTGCAAGG - Intergenic
1002106525 5:176881933-176881955 CGGCAAGCAGAGGTGTGGGCTGG - Exonic
1002162044 5:177320104-177320126 GGGGAAGCACCAGTGTTGGTCGG - Intergenic
1002401814 5:178995184-178995206 CGGGAAGCGGCAGGGCTGGAGGG - Intronic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005251594 6:23952313-23952335 TGACAAGGATCAGTGTTGGAAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005554814 6:26965426-26965448 CAGTAAGAAGCAGTGTTTGATGG + Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009029787 6:58042934-58042956 ATGCAAGCAGAAGTGTTGTATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1012848817 6:104423429-104423451 TGACAAGCAGAAGTGATGGAAGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015206182 6:130642359-130642381 CAGAAAGAAGCAGTGTTGGGGGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1016560689 6:145392545-145392567 GGGCAAGGAGAAGGGTTGGAGGG - Intergenic
1019732130 7:2634232-2634254 CGAAAAGCACCAGTATTGGAAGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023932083 7:44712246-44712268 CGGCACCCAGAGGTGTTGGAGGG + Intergenic
1024023895 7:45395128-45395150 CTCCAAGCAGCAGTGTGGAAGGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024853144 7:53744543-53744565 GGGCTAGCAGCAGTGGTGGTGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026808205 7:73441111-73441133 AGGCAAGCAGCAACATTGGAGGG - Exonic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032551070 7:132785142-132785164 CTGGAGGCAGCAGTGCTGGATGG - Exonic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035725262 8:1820841-1820863 CCCAATGCAGCAGTGTTGGAAGG + Intergenic
1035954777 8:4064671-4064693 AGGGCAGCAGCAGTGTTGGAGGG - Intronic
1036949153 8:13124379-13124401 TGGGAAGCAGAAGTGTTGGGAGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037648693 8:20817066-20817088 TGACCAGCAGCAGTGGTGGATGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041144061 8:54853325-54853347 CAGGAAGCAGCAGTGAAGGAAGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041945245 8:63433610-63433632 TGCCAAACAGCAGTGTTGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043143848 8:76625719-76625741 AAGCAAGCAGCAATGTTAGAAGG + Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052605872 9:30699860-30699882 AGAGAAGCAGCTGTGTTGGAAGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1059634554 9:116158123-116158145 TGGCAAGCAGAGGTGCTGGATGG - Intronic
1185560908 X:1060072-1060094 CGGCGTTCAGCAGTGGTGGACGG - Intergenic
1186451860 X:9680569-9680591 AGGCAAGCAGGAGGGCTGGATGG - Intronic
1187701510 X:21968168-21968190 TGGCCAGCAGCAGTGCTGCAGGG + Intronic
1188124338 X:26349916-26349938 CAGCCAGCAGCATTTTTGGAAGG + Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189688956 X:43595346-43595368 AGGCAAGCAGCAATTTTGAAAGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193211200 X:78809126-78809148 CTGCAAGCAGAAGTGGTGGTGGG - Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196008787 X:110864242-110864264 AGGCCATCAGCATTGTTGGAGGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196326095 X:114404947-114404969 CCCCAAGCAACAGTGTTGGGAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196993630 X:121356620-121356642 TGGCGATCAGCAGTGGTGGACGG - Intergenic
1197378865 X:125713904-125713926 GGGGAAGCTGCAGTGTGGGAAGG - Intergenic
1197482554 X:127005011-127005033 AGGGAAGCTGCAGTGTTGGGAGG - Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198540682 X:137636257-137636279 CAGCAAGCAGCAGCCTTGCAAGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200064237 X:153497108-153497130 CGACAAGCAGGGGTGTTGGGGGG - Intronic
1200136947 X:153879822-153879844 CAGCCAGCAGCAATATTGGAAGG - Intronic
1200415982 Y:2910352-2910374 CGGCGATCAGCAGTGGTGAACGG + Intronic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic