ID: 966355174

View in Genome Browser
Species Human (GRCh38)
Location 3:179071921-179071943
Sequence GCTCCCGCATCCCCGGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966355167_966355174 8 Left 966355167 3:179071890-179071912 CCCGGCAGCGGTGGCAGCGGTAG 0: 1
1: 0
2: 3
3: 29
4: 246
Right 966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 125
966355168_966355174 7 Left 966355168 3:179071891-179071913 CCGGCAGCGGTGGCAGCGGTAGC 0: 1
1: 1
2: 4
3: 34
4: 290
Right 966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966355174 Original CRISPR GCTCCCGCATCCCCGGCGGG CGG Exonic
900168534 1:1254793-1254815 GCTCCCGGCTCCTCAGCGGGTGG - Intronic
900467034 1:2830890-2830912 TCTCCCGGAGCCCCGGCGAGGGG + Intergenic
901007754 1:6180014-6180036 GGCCCCGCATGCCCGGCGCGGGG + Exonic
901098461 1:6701529-6701551 GCCCCGGAACCCCCGGCGGGAGG + Intronic
901109961 1:6785943-6785965 GCCCCCGCACCCCCGGCGCTGGG + Intronic
903652420 1:24930092-24930114 AGTCCCGCATCCTCGGCGCGCGG + Intronic
903986900 1:27235003-27235025 GCTCCCGCAGCCCCGGTGAACGG + Intronic
904480202 1:30788557-30788579 GCTCATGCATCCCCAGCTGGTGG + Intergenic
905656324 1:39688336-39688358 TCTCCCTCATCCCCGGGGTGTGG + Intronic
905789763 1:40783875-40783897 CCTCCCGCTTCCCCGGCGACTGG - Intergenic
905887166 1:41497511-41497533 GCTTCCCCATCCCTGGTGGGGGG + Intergenic
906948204 1:50313602-50313624 GCTCCTCCATCCCTGGCAGGTGG - Intergenic
907406667 1:54258026-54258048 CGCCCCGCGTCCCCGGCGGGCGG + Intronic
911121277 1:94299728-94299750 GCTCCCTTATCCCCAGAGGGTGG - Intergenic
912381278 1:109249550-109249572 TCCCTCGCCTCCCCGGCGGGCGG - Intergenic
914994833 1:152534379-152534401 GCTCCTGCCGCCCCGGCAGGAGG - Intronic
922447628 1:225711057-225711079 GCTCCAGCATCCCTGCCGAGAGG - Intergenic
922696942 1:227735602-227735624 CTTCCCGCATCCCCGGGGGGTGG + Intronic
922937256 1:229432238-229432260 GCCCCTGCACCCCGGGCGGGAGG - Intronic
924118507 1:240771739-240771761 GCGGCAGCATCCCGGGCGGGTGG - Intergenic
924853998 1:247857676-247857698 GCGCCCGCAGCCCCCGCCGGGGG - Intronic
1066022773 10:31319583-31319605 GCCGCCGCATCCCCGGCGCAGGG + Intronic
1066370635 10:34815521-34815543 GGTCCCGCGCCCCCGGAGGGAGG - Intergenic
1067711726 10:48655964-48655986 GCACCCGCATCTCCCGCCGGTGG + Intronic
1075885498 10:125896229-125896251 GCTCCCGATTCCCGGGAGGGCGG + Intronic
1076372786 10:129965548-129965570 GCTGCCCCAGACCCGGCGGGAGG - Intergenic
1076752291 10:132549591-132549613 GCTCCCGCTTGCCTGGCAGGTGG + Intronic
1076998600 11:311156-311178 GCTTCCCCCTCCCCGCCGGGCGG - Intronic
1077000143 11:318603-318625 GCTTCCCCCTCCCCGCCGGGCGG + Intergenic
1077051312 11:568277-568299 CCCCCCGCAGCCCCCGCGGGAGG + Intergenic
1077147922 11:1054119-1054141 CCTCCCGGATCCCCGGGGGAGGG - Intergenic
1077217934 11:1402810-1402832 GCTCCCGCCTCCTCTGCTGGGGG - Intronic
1077431899 11:2519986-2520008 GCTCCCGCGTCCTGGGTGGGTGG - Intronic
1077554179 11:3218030-3218052 GCTCCCGCTTCCCGGGCTGTCGG + Exonic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1081966601 11:47173818-47173840 GCTGGCGCATCCCAGGCAGGGGG + Exonic
1088279486 11:108121763-108121785 GCTCCCGCGGCCCGGGCGCGCGG + Intronic
1088904317 11:114142840-114142862 CCTCCCCCATCCCCATCGGGAGG + Intronic
1089567835 11:119381443-119381465 CCTCCCGGATCCCCGACAGGTGG + Intronic
1095949288 12:47773217-47773239 GCTCCCGCGGCTCCGGCTGGCGG + Exonic
1100186467 12:92145310-92145332 GTTCCCGCAGCCCCGACGGCCGG + Intronic
1104692756 12:130839090-130839112 GGTCCCGCATCCCCGCCGGCCGG + Exonic
1104976773 12:132555671-132555693 ACTCCGGCATCCCTGGCTGGTGG + Intronic
1106242162 13:27920876-27920898 GTTCCCGGATCCCCTGCTGGAGG - Intronic
1110705883 13:78602014-78602036 GCTGCCGCACCCCGGGCTGGTGG - Exonic
1114612629 14:24052523-24052545 GTCCCCGCTTCCCCGCCGGGCGG + Intronic
1118514392 14:66509172-66509194 GATCCCCCATCCCCCGAGGGAGG - Intronic
1119326037 14:73759989-73760011 GCTCCTGCATCGCAAGCGGGGGG - Exonic
1119701951 14:76761689-76761711 GCTCGCGCAGCCTCGGCCGGCGG - Intergenic
1122887221 14:104715477-104715499 GCTCCCGCAGCCCTGGTGGTGGG + Intronic
1123425500 15:20167656-20167678 GCTGCCGCATTCCCGGCAGAGGG - Intergenic
1123534722 15:21174174-21174196 GCTGCCGCATTCCCGGCAGAGGG - Intergenic
1124340467 15:28886541-28886563 GCTCTCGCATCCCGCGCGGGGGG + Intronic
1129644858 15:77420300-77420322 TCTCCCTCAGCCCCAGCGGGAGG + Intergenic
1130115319 15:81001012-81001034 CCTCCGGCAGCCCCTGCGGGCGG + Exonic
1132186626 15:99806727-99806749 CTTCCCTCATCTCCGGCGGGAGG - Intergenic
1132314373 15:100879661-100879683 GCTCCCGCAGGGGCGGCGGGCGG + Exonic
1132429061 15:101745984-101746006 CTTCCCTCATCTCCGGCGGGAGG + Intergenic
1132853043 16:2033376-2033398 GCTCCCGGAGCCCGGGCAGGTGG - Intronic
1133021774 16:2970012-2970034 GCTTCCGTTTTCCCGGCGGGTGG + Intronic
1134220309 16:12348432-12348454 GCTCCCACATCCCCCTCAGGGGG - Intronic
1136453994 16:30370206-30370228 TCTGCGGCCTCCCCGGCGGGGGG - Exonic
1141875274 16:86819825-86819847 GCGCCAGCATCCCCGGCTGGGGG - Intergenic
1142549943 17:732408-732430 TCCCCGGCGTCCCCGGCGGGCGG - Exonic
1142614141 17:1125225-1125247 GCGCCCGCAGCCAGGGCGGGGGG - Exonic
1143627913 17:8121683-8121705 GCGCCAGAATCCCCGGCGCGCGG + Exonic
1145397382 17:22506489-22506511 GCTCCCGCCTCCCCGCCTGCTGG - Intergenic
1145969992 17:28950996-28951018 GCCCCCCCAACCCCGGGGGGAGG + Exonic
1146650360 17:34602614-34602636 GCTTCAGCATCCCCTGCAGGAGG + Intronic
1147958474 17:44151305-44151327 GCTCCAGCTTCCCCTGGGGGAGG + Intronic
1148615343 17:48996811-48996833 GGTCCTGCATCCCCGGAGGCGGG + Intergenic
1151966503 17:77434305-77434327 GCTCCTGCAGGCCCTGCGGGTGG - Intronic
1152548929 17:81019666-81019688 GCTCCCGCCTCCCCGGAGTGGGG - Intergenic
1152700968 17:81819620-81819642 GCTCCCGCAGCCCAGGGGAGAGG + Intergenic
1153290751 18:3499328-3499350 GCTCCCGGATCAGCGGCGCGGGG + Exonic
1157155630 18:45262661-45262683 GCTCCCCCATCCAGGGTGGGAGG - Intronic
1160583383 18:79900135-79900157 GCTCCCTCCTCCCTGGCTGGAGG - Intronic
1160690876 19:460377-460399 GGACCCCCATCCCCGGCCGGCGG - Intronic
1160896841 19:1407145-1407167 CCGCCCGCACCCCAGGCGGGCGG - Intergenic
1162592897 19:11604602-11604624 GCTCCTTCATCCCCAGTGGGAGG + Intronic
1167007883 19:46787373-46787395 GCTCCCGCTCCCCCGGGAGGTGG - Intronic
1167338025 19:48898483-48898505 TCTCCCGGATCCCAGGCAGGTGG - Intronic
1168581490 19:57559251-57559273 GCTTCCTCAACCCCGGGGGGGGG + Intronic
926202553 2:10812445-10812467 GCTTCCGCAGCCGCGGGGGGCGG - Intronic
927720183 2:25377407-25377429 GCTCCCCTCTCCCTGGCGGGTGG + Exonic
928313808 2:30231393-30231415 GCGCTCGCAGCTCCGGCGGGCGG - Intergenic
930730417 2:54723614-54723636 GCCCCCGGAGCCCCGGCTGGAGG + Intronic
937418674 2:121737273-121737295 GCTCCCGCACCCTCGGCTGTCGG + Intronic
944616556 2:201465928-201465950 CCTCCCGCATCCCCCGGGGAGGG - Intronic
948689029 2:239690675-239690697 ACCCCGGCATCCCGGGCGGGCGG + Intergenic
1172118603 20:32585148-32585170 GCTCCTGCATCCCGGCCGGGGGG - Intronic
1175668721 20:60882703-60882725 GCTCCCGCATCCCCTGCCAGCGG + Intergenic
1178924253 21:36761831-36761853 GCCCCTGCCTCGCCGGCGGGAGG + Intronic
1180092166 21:45538732-45538754 ACCCCAGCATCCCCGGCGGCAGG + Intronic
1181026984 22:20132198-20132220 ACTCCCCCAGCCCCAGCGGGTGG - Intronic
1183667803 22:39255257-39255279 CCTCCCCCATCCCAGGCTGGTGG - Intergenic
1184194634 22:42918735-42918757 GCTCCAGCCTCCCTGGCAGGTGG - Intronic
963121563 3:141781014-141781036 GCTCCCCCATCCCCTGTGAGAGG - Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
964041817 3:152269498-152269520 GCTCCCGCATCCCTGGCCCCGGG + Intronic
966182349 3:177197986-177198008 GCTCCCGCGTGTCCGGGGGGCGG + Intergenic
966355174 3:179071921-179071943 GCTCCCGCATCCCCGGCGGGCGG + Exonic
966390944 3:179451608-179451630 GCGCGCGCAGCCCGGGCGGGGGG + Intergenic
966732733 3:183163828-183163850 GCTGCCGACTCCCCGGCGTGCGG + Intronic
972162593 4:36244542-36244564 GCTCCGGCTTCCCCCGCGCGGGG - Intergenic
975883569 4:78939267-78939289 GGTCCCGCCTCCCCGGGGAGGGG + Exonic
982695338 4:158592539-158592561 GCTCCCGTAGCCCAGGCTGGAGG - Intronic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
985930831 5:3056476-3056498 GCTCCCTCTCCCCCGGCGGCGGG + Intergenic
990955458 5:61333948-61333970 GCTCCCGCGTCCCCGCGGCGCGG + Intronic
1002302972 5:178268032-178268054 GCTCCCGCAGCCCTGGTGGTTGG + Intronic
1016840530 6:148520120-148520142 GCTGCGGCTTCCCCGGCAGGAGG + Intronic
1019331825 7:464104-464126 GCTGCCGCGTCCCCGGCTGCAGG + Intergenic
1020280228 7:6646560-6646582 CCTCCTGCATCCCCTGCGGATGG + Intronic
1022898938 7:34782359-34782381 GCTCCAGCTTCCCTGGTGGGGGG + Intronic
1026360501 7:69598231-69598253 GCCCCCGCGGCCCCGGCCGGCGG - Intergenic
1030316390 7:108119161-108119183 GATCCCGCATACCCTGCTGGTGG + Intronic
1031051863 7:116953402-116953424 GAGCCCGCGTCCCCGGCGGCGGG + Exonic
1034441383 7:151087504-151087526 GCGCCCGCAGGCCCGGAGGGTGG + Intronic
1035167442 7:157000051-157000073 GCTCCCCCATCCGCGGCTGCAGG - Intronic
1035171972 7:157021890-157021912 GCTCCCAAGACCCCGGCGGGAGG - Intergenic
1037948314 8:23003213-23003235 GCTCCCTAATCCCAGGAGGGTGG + Intronic
1039907638 8:41798200-41798222 GCTCCAGCCTCCCCGGGGGGCGG - Intronic
1041453589 8:58033873-58033895 GCTCTGGCATCCCAGGAGGGAGG - Intronic
1049194512 8:141308102-141308124 GCCCCCGCGGCCCCGGCCGGAGG - Intronic
1049571130 8:143370786-143370808 GCCCCTGCAGCCCCTGCGGGAGG - Intronic
1049833081 8:144714314-144714336 GCTCCCTCCACCCCGACGGGAGG - Intergenic
1054762078 9:69012892-69012914 GCTCCCCCAACCCTGGAGGGTGG + Exonic
1058504686 9:105656008-105656030 GCTCCCCCAGCCCAGGTGGGTGG + Intergenic
1060968546 9:127724906-127724928 GCTCCCGCCCCCACGGTGGGCGG + Intronic
1061516776 9:131094729-131094751 GTCCCAGCATCCCCGACGGGTGG + Intergenic
1061540692 9:131276762-131276784 GCTCCCCCGTCACCGGCGAGCGG - Intergenic
1061895111 9:133643112-133643134 GCTCCTGCAGCCCCAGTGGGAGG - Intronic
1185504778 X:624152-624174 GGACCCCCAGCCCCGGCGGGCGG + Intergenic
1195100607 X:101551327-101551349 CCTCCCGCAGCCCCAGCGGTCGG - Intronic