ID: 966355703

View in Genome Browser
Species Human (GRCh38)
Location 3:179076360-179076382
Sequence TACAGCTGTCCCTCAGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966355703_966355706 -5 Left 966355703 3:179076360-179076382 CCACATACTGAGGGACAGCTGTA No data
Right 966355706 3:179076378-179076400 CTGTAGCTGATGGGACTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966355703 Original CRISPR TACAGCTGTCCCTCAGTATG TGG (reversed) Intergenic
No off target data available for this crispr