ID: 966359062

View in Genome Browser
Species Human (GRCh38)
Location 3:179114889-179114911
Sequence TCTTTTCATAAATCATGTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966359062_966359065 8 Left 966359062 3:179114889-179114911 CCACTACATGATTTATGAAAAGA No data
Right 966359065 3:179114920-179114942 TGTAGTTTTCGGAGCACTTGAGG No data
966359062_966359063 -3 Left 966359062 3:179114889-179114911 CCACTACATGATTTATGAAAAGA No data
Right 966359063 3:179114909-179114931 AGAAAAAAACCTGTAGTTTTCGG No data
966359062_966359066 23 Left 966359062 3:179114889-179114911 CCACTACATGATTTATGAAAAGA No data
Right 966359066 3:179114935-179114957 ACTTGAGGTTTCTAAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966359062 Original CRISPR TCTTTTCATAAATCATGTAG TGG (reversed) Intergenic
No off target data available for this crispr