ID: 966359065

View in Genome Browser
Species Human (GRCh38)
Location 3:179114920-179114942
Sequence TGTAGTTTTCGGAGCACTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966359062_966359065 8 Left 966359062 3:179114889-179114911 CCACTACATGATTTATGAAAAGA No data
Right 966359065 3:179114920-179114942 TGTAGTTTTCGGAGCACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966359065 Original CRISPR TGTAGTTTTCGGAGCACTTG AGG Intergenic
No off target data available for this crispr