ID: 966362875

View in Genome Browser
Species Human (GRCh38)
Location 3:179148673-179148695
Sequence CCGGGCGCGCCCGCCGTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 50}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966362859_966362875 26 Left 966362859 3:179148624-179148646 CCGGTAGCGGGTGCGGTGGGAAT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 966362875 3:179148673-179148695 CCGGGCGCGCCCGCCGTGTTGGG 0: 1
1: 0
2: 1
3: 1
4: 50
966362868_966362875 -2 Left 966362868 3:179148652-179148674 CCGGGTGGGTGCCGGAGACTCCC 0: 1
1: 0
2: 0
3: 13
4: 162
Right 966362875 3:179148673-179148695 CCGGGCGCGCCCGCCGTGTTGGG 0: 1
1: 0
2: 1
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966362875 Original CRISPR CCGGGCGCGCCCGCCGTGTT GGG Intronic
900082626 1:869927-869949 GGGGGCGCGCCCGCGGTGTCCGG + Intergenic
902169729 1:14599637-14599659 CCGGGCTCTGCCGCCGTGGTTGG + Intronic
904494980 1:30881510-30881532 CCGGGCACGCTCGCTGTGTGTGG - Intronic
917817667 1:178726032-178726054 CCGGGCGCGCGGGCCGGGTGTGG + Intronic
1063458983 10:6203542-6203564 CCGGGCGCACTCGCCGTTTCCGG - Intronic
1063665044 10:8055888-8055910 CCGGGCGCACTCACCGTGGTGGG - Exonic
1076358989 10:129873498-129873520 GCGGGCCCGCCTCCCGTGTTTGG + Exonic
1077635772 11:3840743-3840765 CCGGCCGCGCCCGCCCTACTTGG + Intronic
1089610348 11:119665251-119665273 CCCGGCGCGCCGCCCATGTTCGG + Exonic
1095261682 12:40105699-40105721 CCGGCCGCGCTCGCCGCGTCCGG + Exonic
1114031426 14:18583869-18583891 AGGGGCGCGCCCGCGGTGTCCGG + Intergenic
1116437612 14:44912342-44912364 GCGGGCGGGCCTGCCGTGCTGGG - Intergenic
1122624252 14:103075944-103075966 CCGCGCCCGCCCGGGGTGTTTGG - Intergenic
1134213136 16:12294793-12294815 CCGGGAGCTCCAGCTGTGTTAGG - Intronic
1137476041 16:48810973-48810995 CCGGCCTCGCCCGCCCAGTTGGG + Intergenic
1140227777 16:73092631-73092653 CCGAGCGCGAACGCCGTGTCTGG + Intergenic
1141764960 16:86052119-86052141 CTGGGCGGGGCCGCCTTGTTGGG + Intergenic
1142256123 16:89014688-89014710 CTGGGCGCTCCCACAGTGTTGGG - Intergenic
1142670700 17:1486194-1486216 CCGGGCGCGCCGGCCGTATTTGG - Intronic
1143783247 17:9240277-9240299 CTGGGCGCGGCCGCCGTGGAGGG + Exonic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1152654519 17:81513538-81513560 CCAGGCGCGCGCTCCGGGTTGGG + Intronic
1153457241 18:5295317-5295339 CCGGGTGCGCCCGCGGAGCTTGG - Intronic
1160909219 19:1467206-1467228 CCCGGCGCCCCCGCCGCGCTCGG - Exonic
1162524144 19:11197643-11197665 CCGGGCGCCCCGGCCGCGGTGGG + Intronic
1168153941 19:54463021-54463043 CCGTGGGCGCCCTCGGTGTTCGG + Exonic
932611388 2:73202772-73202794 CCGGGAGCGCGGGGCGTGTTCGG - Exonic
934031844 2:88055525-88055547 CGGGGCGCGCCCGGCGGGCTGGG + Intronic
936081274 2:109434226-109434248 CTGGGCTCGCCCGCCCTGCTGGG + Intronic
938496773 2:131801926-131801948 GGGGGCGCGCCCGCGGTGTCCGG - Intergenic
947860659 2:233354940-233354962 CGGGGGGCGCGCGCCGAGTTGGG + Intronic
1175428738 20:58888769-58888791 CGGCGCGCGCCCGCCGAGGTAGG - Intronic
1176311843 21:5154755-5154777 CCGGGCGCGCGCGCTGTGGGCGG - Intergenic
1179845206 21:44107280-44107302 CCGGGCGCGCGCGCTGTGGGCGG + Exonic
1180455539 22:15510926-15510948 AGGGGCGCGCCCGCGGTGTCCGG + Intergenic
1181026781 22:20131615-20131637 CCGCGGGCGCCCGCCGGGCTGGG + Intronic
1182296497 22:29313551-29313573 TCGGGCGCGCCCGCCGGCCTGGG + Exonic
1185409576 22:50674762-50674784 CCGGGCGCGCCCGGCGGGGGTGG - Intergenic
960717944 3:120596193-120596215 CCGAGCGAACGCGCCGTGTTCGG + Intergenic
961666614 3:128496870-128496892 CCCGGTGTGCCCGGCGTGTTTGG + Intergenic
966362875 3:179148673-179148695 CCGGGCGCGCCCGCCGTGTTGGG + Intronic
968872641 4:3249566-3249588 CCGGGCCCGCCCGTCCTGGTGGG - Intronic
972245818 4:37244692-37244714 CCGCCCGCGCCCGCCGTGGGAGG - Exonic
996738299 5:126777027-126777049 CGGGGCGTGCCGGCCATGTTGGG + Intronic
1003107925 6:3229433-3229455 CCGGGCACGCCGGCCGGGTCTGG - Intronic
1003175606 6:3750960-3750982 CCGGGCGCCCCCGCCCTCCTCGG + Intronic
1007446078 6:41907181-41907203 CCAGGGGCTCCCGCAGTGTTTGG - Exonic
1022675491 7:32495474-32495496 CCGGCGGCGGCCGCCGTGTCAGG + Exonic
1035751834 8:2001991-2002013 CTGCGCGAGCCCGCCGTGTTCGG + Exonic
1042246264 8:66712307-66712329 CCGGGTGGGCCCGTGGTGTTGGG - Intronic
1060952271 9:127612026-127612048 CCGGGCGCGCGCGGCGCGTGAGG + Intergenic
1061250093 9:129421490-129421512 CTGAGCACGCCCACCGTGTTGGG - Intergenic
1062243715 9:135552802-135552824 CCGGGGGTGCCCGCCCTGTGAGG - Intergenic