ID: 966369134

View in Genome Browser
Species Human (GRCh38)
Location 3:179228548-179228570
Sequence AAATCTGGCCTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 2, 2: 8, 3: 22, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966369134 Original CRISPR AAATCTGGCCTCACAAAGAT AGG (reversed) Intronic