ID: 966370595

View in Genome Browser
Species Human (GRCh38)
Location 3:179247555-179247577
Sequence CTCGGTTCTCATAACTACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966370595_966370599 -4 Left 966370595 3:179247555-179247577 CCCTTGTAGTTATGAGAACCGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 966370599 3:179247574-179247596 CGAGCTACAAAGTTGCCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
966370595_966370602 22 Left 966370595 3:179247555-179247577 CCCTTGTAGTTATGAGAACCGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 966370602 3:179247600-179247622 CCTAGCAGCCAAAGCAATGAAGG 0: 1
1: 0
2: 13
3: 41
4: 231
966370595_966370598 -5 Left 966370595 3:179247555-179247577 CCCTTGTAGTTATGAGAACCGAG 0: 1
1: 0
2: 0
3: 2
4: 52
Right 966370598 3:179247573-179247595 CCGAGCTACAAAGTTGCCTCTGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966370595 Original CRISPR CTCGGTTCTCATAACTACAA GGG (reversed) Intronic
901290610 1:8121333-8121355 ATCCCTTCTCATAACTACACAGG - Intergenic
903444791 1:23415530-23415552 CAAGGTTCTCATAACCACACAGG + Intronic
905018085 1:34791260-34791282 CTCGGTTCTCATGCCCTCAAGGG + Intronic
910344472 1:86220060-86220082 CTGGGCTTTCATCACTACAAGGG - Intergenic
914798438 1:150941535-150941557 CTGGGATTTCATAACTACTAAGG - Intronic
919797819 1:201331929-201331951 CTGGGTTCTGATGACAACAAAGG - Exonic
923607157 1:235454383-235454405 CTCCTTTATCATCACTACAAAGG + Intronic
1063811749 10:9718609-9718631 CTCAGTTCACATATTTACAATGG + Intergenic
1064647385 10:17473378-17473400 CCCGGTGCTGATAACAACAAGGG - Intergenic
1071882536 10:89915070-89915092 CTCAGCTCTCATCAGTACAAAGG - Intergenic
1081647022 11:44797223-44797245 CTCGGTTCTCATCTGTAAAATGG - Intronic
1087835346 11:102869041-102869063 CTCTCTTCTCTTACCTACAAAGG - Intronic
1089911526 11:122105520-122105542 CTCTGAGCTCAGAACTACAAAGG + Intergenic
1095978198 12:47954154-47954176 CTCACTTCTCATAACTGCGACGG + Intergenic
1125336534 15:38631961-38631983 CTTGGTTCTCACAACTGGAAAGG + Intergenic
1128665564 15:69535621-69535643 CCCAGTTCTCATAAATACACAGG + Intergenic
1130739377 15:86582101-86582123 TTTGGTTGTCATAACTACAGGGG - Intronic
1136333866 16:29599011-29599033 CTCGGTTCCCATGACTGAAATGG - Intergenic
1142534359 17:603989-604011 CTTGCTTTTCATATCTACAAAGG - Intronic
1155245132 18:23901054-23901076 CTGGGTTATAAAAACTACAAAGG - Intronic
1159719462 18:71869392-71869414 CTGTGTTCTCATAACGACCAAGG - Intergenic
929018798 2:37529474-37529496 CTTGGTTCTAATAACTAGAATGG - Intergenic
929915938 2:46135680-46135702 CTCGGTTATCAGCACTGCAATGG + Intronic
937853112 2:126653428-126653450 CTGGGTTCTCATCTTTACAATGG + Intergenic
941438020 2:165496022-165496044 CTCGGGTCACAGAACTACATGGG - Intronic
944987829 2:205198570-205198592 CTGAGTTCTCACATCTACAAAGG + Intronic
946231089 2:218291795-218291817 CTGGGTTCACAGAACTACAGGGG - Intronic
1170908366 20:20538193-20538215 CTTGGTTCCCATAAGTACACAGG + Intronic
1178018156 21:28376330-28376352 CCTGGTTCTTATAACTAAAAAGG + Intergenic
950597753 3:13999626-13999648 CTCTGTTCTCACAAGTAAAAAGG - Intronic
954930803 3:54279752-54279774 CTCTGTTCTCAAAACGAGAATGG + Intronic
955802474 3:62700470-62700492 CTTAGTTCTCATTATTACAATGG + Intronic
959570395 3:107876975-107876997 CTCTGTTCACATCACTCCAAAGG - Intergenic
964444368 3:156743216-156743238 CAATGTTCTCATAAATACAATGG - Intergenic
966370595 3:179247555-179247577 CTCGGTTCTCATAACTACAAGGG - Intronic
971046589 4:22811724-22811746 CTCATTTCTCATGAATACAATGG - Intergenic
975106488 4:70573393-70573415 CTCGGGTCCCACAACCACAATGG + Intergenic
975401750 4:73945937-73945959 CTCACTTCTCATAACTACCTTGG - Intergenic
993800651 5:92331238-92331260 CTCAGTAGTCATAACTGCAATGG + Intergenic
997727020 5:136130236-136130258 CTCGGTTGTCACAACTAGGAGGG - Intergenic
999091162 5:148937224-148937246 CCAGGTTCTCATAACTAGCAAGG + Intronic
1000470567 5:161635012-161635034 CTCGGTTTCCGTATCTACAAAGG + Intronic
1007542708 6:42663637-42663659 CTTGGTTTTCATAAATACATAGG - Intronic
1009431534 6:63572142-63572164 CACGTTTCTCATAATTAAAACGG - Exonic
1013568843 6:111399590-111399612 ATCAGTTCTCATGACTGCAAAGG - Intronic
1018649421 6:165979810-165979832 TTGAGTTCTCATAACCACAATGG - Intronic
1021583722 7:22185343-22185365 CCTGGTTCTCATAGCTAGAAGGG + Intronic
1047576160 8:126157789-126157811 CTCTGTTCTCCTAACTCCAAGGG + Intergenic
1051850816 9:21505664-21505686 CTCTGTTCTCATAATTAGATTGG - Intergenic
1053607656 9:39677573-39677595 CTGGGTTCTCATAACTCCCTAGG - Intergenic
1054245878 9:62664833-62664855 CTGGGTTCTCATAACTCCCTAGG + Intergenic
1054560004 9:66699366-66699388 CTGGGTTCTCATAACTCCCTAGG + Intergenic
1055100991 9:72465436-72465458 CTCTGTTCTCATGACTAAAGAGG + Intergenic
1058782093 9:108348029-108348051 CTTTGTTCTCATATCTAGAAAGG - Intergenic
1188302452 X:28521797-28521819 CTCTGTTTTCATTACTTCAAAGG + Intergenic