ID: 966373119

View in Genome Browser
Species Human (GRCh38)
Location 3:179268850-179268872
Sequence CTGCTTTTCCAGAGTAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 292}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
966373114_966373119 -4 Left 966373114 3:179268831-179268853 CCTTTAAAAACTTCCTGCCCTGC 0: 1
1: 0
2: 0
3: 18
4: 207
Right 966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG 0: 1
1: 0
2: 0
3: 31
4: 292
966373113_966373119 -3 Left 966373113 3:179268830-179268852 CCCTTTAAAAACTTCCTGCCCTG 0: 1
1: 1
2: 1
3: 31
4: 235
Right 966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG 0: 1
1: 0
2: 0
3: 31
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
966373119 Original CRISPR CTGCTTTTCCAGAGTAAAAA GGG Intergenic
901518586 1:9766172-9766194 CTGCTTTTCCAGATTAAGTATGG - Intronic
901567816 1:10133164-10133186 CTGCTTTGCCAGAGGAGAAAAGG + Intronic
901871876 1:12143050-12143072 TTGTTTCTCCAGAGTCAAAAGGG + Exonic
902044698 1:13515462-13515484 CTGCTTTTGCAGAGTTGCAAGGG - Intergenic
903356407 1:22750617-22750639 CTGCTTTTCCCAATTGAAAAGGG - Intronic
904290834 1:29485036-29485058 CTGCTTTTCCAGAGCTTACATGG - Intergenic
906584130 1:46961552-46961574 CTGCTCTTCCTGAGAACAAAGGG + Intergenic
907179175 1:52553936-52553958 CTGCCTTTTCAAAGGAAAAAAGG - Intergenic
907629324 1:56064074-56064096 CTGCTTTTCTAGAGAAATCAAGG + Intergenic
908088469 1:60661812-60661834 CTTCATTACCAGAGAAAAAAAGG - Intergenic
908882565 1:68748704-68748726 TTTCCTTTCCAGAGTAATAAAGG - Intergenic
910263859 1:85317308-85317330 CTGCTCCTCCAGAGGAGAAAGGG - Intergenic
910501858 1:87901105-87901127 CTGGTTTTACAAAGTAAACATGG - Intergenic
911991960 1:104709777-104709799 TTCCTTTTCCAGAGAAAAGAAGG + Intergenic
912033126 1:105274688-105274710 CTGCTTTTCCTGAGTCACACAGG + Intergenic
915073876 1:153293417-153293439 CTGCTTCTCCAAACTAGAAATGG - Intergenic
915804819 1:158835064-158835086 CTTGTTTTCAAGATTAAAAAAGG + Intronic
916463556 1:165049875-165049897 CTGCTTTTCCAGAGTTCAGAGGG - Intergenic
916837781 1:168566319-168566341 CTGCTCTACCAGAAAAAAAATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917675613 1:177316372-177316394 CTGCTTTCCCAAAGGATAAAAGG + Intergenic
917759250 1:178137471-178137493 CTGCTTCAGCACAGTAAAAACGG - Intronic
918007299 1:180553916-180553938 CTGCTTGTACATAGGAAAAAGGG + Intergenic
918313751 1:183305558-183305580 CTGTTTTTCCTGGGTAAAACAGG + Intronic
918376983 1:183919008-183919030 ATGCTGTTTCAGAGTATAAAGGG - Intronic
918432293 1:184474544-184474566 CTGCTTTTCGGGAGTAGCAAAGG + Intronic
918469077 1:184851886-184851908 TTGCCTTTCCAGAGTCAAAATGG + Intronic
919469625 1:197962168-197962190 CTCCTTTTTGAGGGTAAAAAGGG + Intergenic
919534015 1:198763759-198763781 CACCCTTTCCAGAGTAAAAATGG + Intergenic
921492512 1:215795457-215795479 GTGCTTTGCAAGTGTAAAAATGG - Intronic
922621187 1:226989460-226989482 CTGCTTTTCTGGAGTTAGAATGG - Intergenic
923227652 1:231954075-231954097 CAGCTTTTTCAGTGTAAACACGG - Intronic
923420249 1:233807347-233807369 CTTCTTTGGCAGAGGAAAAAAGG - Intergenic
924471094 1:244343346-244343368 CTGCCTTTCCTAAGTATAAAGGG + Intergenic
924833873 1:247628615-247628637 CTGCTTTTCTCAAGTAGAAAGGG + Intergenic
1062841706 10:678284-678306 CTGCTTTTCCAGAGGAAAGCTGG - Intronic
1062969692 10:1637424-1637446 TTGCTTTTCAAGAGTATAATGGG - Intronic
1063593761 10:7413994-7414016 CTGCTTTTTTAAAGTAAAGAAGG + Intergenic
1064031474 10:11885812-11885834 CAGCTTCTCCAGAGGAACAAGGG + Intergenic
1064644079 10:17442930-17442952 CTGCTGTTCTAGATTATAAATGG + Intronic
1065368948 10:24963127-24963149 CACCTTTTCCAGAGAATAAAGGG + Intergenic
1067718188 10:48705426-48705448 CTTCTTATCCAGGGTGAAAAGGG - Intronic
1069117198 10:64522518-64522540 CTCATTTTCCAGAGTAAAACTGG - Intergenic
1069319547 10:67151561-67151583 CTTATTTTCCAGGGTGAAAAGGG - Intronic
1069966971 10:72127461-72127483 AGGCTGTTCCTGAGTAAAAATGG + Intronic
1071730321 10:88242110-88242132 TTGCCTTTCCAGTTTAAAAAAGG - Intergenic
1071987422 10:91066235-91066257 CTTCTTTTCCAAATTTAAAATGG + Intergenic
1073305187 10:102497724-102497746 CTTATCTTCCAGAGTATAAAAGG + Intronic
1075218986 10:120567758-120567780 TTGCTTTCCCAGATTTAAAATGG + Intronic
1078380097 11:10832357-10832379 CAGCTTTTGCAGATTAGAAATGG - Intronic
1078557779 11:12344416-12344438 CTTCTTTTCCATATGAAAAACGG - Intronic
1081091161 11:38867612-38867634 GTGCTGTTCCAGGGTAACAACGG - Intergenic
1083243486 11:61407511-61407533 CTGCTTTTCCAGAGGATACATGG + Intronic
1085598517 11:77832803-77832825 CTGCTGTTACAGAGCACAAATGG - Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1088762629 11:112947025-112947047 CTGCATTTGCAAAGCAAAAAGGG + Intergenic
1089217571 11:116844050-116844072 CTCCTTTCCCAGAAAAAAAAAGG + Intronic
1089813016 11:121147280-121147302 CTCCTTTTCCAGATGAAAATGGG - Intronic
1090475920 11:127020240-127020262 CTGCTTTTCCAGAGCATATTTGG + Intergenic
1090849417 11:130559137-130559159 CTGCTTTTTCAGAGTATATTTGG - Intergenic
1092657559 12:10702959-10702981 CTGCTTTTATAGGTTAAAAAAGG + Intronic
1093388953 12:18593672-18593694 CAGCTTTTCCTTAGTAAAACTGG - Intronic
1094535331 12:31316813-31316835 CTCCTATTCCATATTAAAAAGGG - Intronic
1095070234 12:37833825-37833847 CTGTTTTTCCAGAATCTAAAAGG + Intergenic
1095950404 12:47778603-47778625 CTACTTTTCAAGAGGATAAAAGG - Intronic
1097851141 12:64411538-64411560 CTGCTTTTTGTCAGTAAAAATGG + Intronic
1097921234 12:65076425-65076447 TTGCTTAACCAGGGTAAAAATGG + Intronic
1098257196 12:68628626-68628648 CTGCTTTTCCAGAAATAAAGAGG + Intronic
1098480678 12:70956022-70956044 ATCCTATTCCAGAGAAAAAATGG - Intergenic
1099564227 12:84220040-84220062 CTGCTTTTCCCGTTTAAATATGG + Intergenic
1101056417 12:100920564-100920586 CTGCTGGTCCAGAATTAAAATGG - Intronic
1101119978 12:101569075-101569097 CTGTATTTCTAAAGTAAAAATGG - Intronic
1103847004 12:123908630-123908652 CTGGTTCTCCAGAGGAACAAGGG + Intronic
1106194705 13:27483415-27483437 CTTCTTTTCCTGTGTGAAAAAGG - Intergenic
1107664042 13:42670776-42670798 TTGCATTTCCAGAGGAAACATGG - Intergenic
1108785238 13:53892382-53892404 CTGCTTTTCCTAATTAAAAGTGG + Intergenic
1108867659 13:54941356-54941378 CTGCTTTTTTAGAGTTAAAGTGG + Intergenic
1109808624 13:67477490-67477512 CTATTTTCCAAGAGTAAAAAAGG - Intergenic
1109930052 13:69204754-69204776 ATGCTTTCCAATAGTAAAAAGGG + Intergenic
1110246334 13:73328479-73328501 CTGCTTTACAAAAGAAAAAAAGG + Intergenic
1110495667 13:76164570-76164592 CTGCTGTTCCAGAGTGCAATGGG + Intergenic
1110957163 13:81568616-81568638 GTGCATTTCCAGAGAGAAAATGG + Intergenic
1110977297 13:81855172-81855194 CGTATTTTCCAGAGTAAATAAGG - Intergenic
1111418717 13:87981460-87981482 CTGCATTTTCAGAATAAGAATGG + Intergenic
1112466409 13:99649111-99649133 CTGCCTGTGCATAGTAAAAATGG + Intronic
1112489941 13:99853404-99853426 CTACATTTTCAGAGTAAACAGGG + Intronic
1113176341 13:107568498-107568520 CTGCCTTTCAAAACTAAAAATGG - Intronic
1113545059 13:111142288-111142310 CGGCTTTTCCTGAGTGAAATGGG + Intronic
1114807869 14:25858495-25858517 CTGATTTTTAAGAATAAAAAGGG + Intergenic
1115271426 14:31557744-31557766 CTTCCTTTCCTGAATAAAAAAGG + Intronic
1115372189 14:32629265-32629287 GTTCTTTTCCAAAGGAAAAAAGG - Intronic
1116543835 14:46136770-46136792 CAGCACTTCCAGAGGAAAAAAGG + Intergenic
1117334208 14:54743020-54743042 CTGCTTCTCCAGAATGAGAATGG + Intronic
1117996043 14:61479219-61479241 CTGCTTTTGCAGTGTAAACGTGG - Intronic
1119324222 14:73750010-73750032 CTGCTTTTCCCTAGGAAAAATGG + Intronic
1120028087 14:79608535-79608557 CTGCTTATCCCTACTAAAAATGG - Intronic
1121433970 14:93906701-93906723 CTCCTTTTCCTGAGTAGAACTGG - Intergenic
1123215253 14:106803251-106803273 CTGCTTTTCATCAGCAAAAAGGG + Intergenic
1123736720 15:23191677-23191699 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287421 15:28414652-28414674 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124287945 15:28420355-28420377 CTGCTGTCCCAGTGGAAAAAGGG + Intergenic
1124295281 15:28496972-28496994 CTGCTGTCCCAGTGGAAAAAGGG - Intergenic
1124608760 15:31193277-31193299 CTGCTTTCCCTCAGGAAAAATGG + Intergenic
1124889458 15:33718734-33718756 CTGTTTTACCAGGGTAAAATGGG + Intronic
1125405076 15:39343932-39343954 CAGTCTTTCCATAGTAAAAAAGG - Intergenic
1125651234 15:41319662-41319684 CTGCCTTTCCAGTGACAAAATGG - Exonic
1126323605 15:47450820-47450842 CTGTTTTTCCCCAGTAACAATGG - Intronic
1126583620 15:50262644-50262666 CTGCTTTTCAAGAGCAAGAAGGG - Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1127389750 15:58495978-58496000 CTTCTTTTCCAGATAAGAAAAGG + Intronic
1128564302 15:68690239-68690261 CTGGGTCTCCAGAGAAAAAAAGG - Intronic
1128853263 15:70984236-70984258 CTGCATTCCCAGAGGAAACAGGG + Exonic
1129696517 15:77743335-77743357 CTCCTTTTACAGAGTACATAGGG - Intronic
1130756424 15:86769248-86769270 CTTATATTCCAGAATAAAAATGG - Intronic
1131222152 15:90593760-90593782 CTCCCTTTGAAGAGTAAAAAAGG - Intronic
1132250376 15:100331554-100331576 CTTCTTATGCAGAGTCAAAATGG + Intronic
1132580516 16:682660-682682 CTGCTTTTCCAGCCCACAAAGGG - Exonic
1133205984 16:4233876-4233898 CTGCTTTTCCAGCCTAAAGGGGG + Intronic
1133663120 16:7938087-7938109 CTTCTGTCCCAGAGTCAAAAGGG - Intergenic
1136265321 16:29113713-29113735 GTGCTCTTCAAGAGAAAAAATGG - Intergenic
1137678747 16:50319857-50319879 CTGCTTTCCCAGAGAAAACAGGG + Intronic
1137705006 16:50529023-50529045 CTCCTTTTACAGAATAAAAGGGG - Intergenic
1138734631 16:59236258-59236280 CTTCTTTTCCACAATAAATAAGG - Intergenic
1139633775 16:68245846-68245868 CTGTCTTTCCAGCTTAAAAATGG - Intronic
1142054126 16:87981645-87981667 GTGCTCTTCAAGAGAAAAAATGG - Intronic
1143750965 17:9027493-9027515 CTGCTTTTCCATAGAATGAATGG + Intronic
1143932314 17:10442061-10442083 CTCCTTTTCTGGAGCAAAAATGG + Intergenic
1144218486 17:13078967-13078989 CTGTTTTTCAAGAGGAAGAAAGG - Intergenic
1144665326 17:17098502-17098524 CTGAGTTTCCAGAGTTGAAAGGG + Intronic
1146364217 17:32206394-32206416 CTGATTCTGCAGACTAAAAATGG - Intronic
1146603594 17:34239003-34239025 CTGGTTTTCTAGAGAACAAAGGG - Intergenic
1146976264 17:37114944-37114966 CACCTTCTCCAAAGTAAAAATGG + Intronic
1148109897 17:45138414-45138436 CTGCTTGCTCAGAGGAAAAAAGG - Intronic
1149638305 17:58187120-58187142 CTTCCTTTCCAGGGTGAAAAAGG + Intergenic
1150575622 17:66428187-66428209 CTGCTGTGCCAGAGTCAACAGGG + Intronic
1150690022 17:67357528-67357550 CTGCTTTTCCAGAGAGAGAAGGG + Exonic
1150986828 17:70207312-70207334 CTGTGTTTAAAGAGTAAAAAAGG - Intergenic
1151111185 17:71679939-71679961 CTGCCTTTCCAGAATCCAAAGGG + Intergenic
1151467704 17:74298258-74298280 CTGCTTTGCCAAAGTAGAACAGG + Intronic
1151955315 17:77377200-77377222 CTACTTTTCCACTGTACAAACGG + Intronic
1152476616 17:80522605-80522627 CTGCTTTTCGAGGCTAAATAAGG + Intergenic
1153611813 18:6893497-6893519 ATGGTTTTCCAGAGTGAAAATGG - Intronic
1155172032 18:23274236-23274258 CTACATTTCCATTGTAAAAATGG + Intronic
1159815961 18:73074064-73074086 TTGTCTTTCCAGATTAAAAAAGG - Intergenic
1162586627 19:11563459-11563481 CTCGTTTTCCAGAGAAAAGAGGG - Intronic
1163883952 19:19949789-19949811 CCATCTTTCCAGAGTAAAAAGGG + Intergenic
1164276681 19:23724775-23724797 CTGCATTTTCAGATTAATAATGG + Intergenic
1167030829 19:46958971-46958993 GTGATTCTCCAGAGGAAAAAGGG + Intronic
925074878 2:1007463-1007485 CTCAGTTTCCACAGTAAAAATGG + Intronic
925390301 2:3489818-3489840 CTGCTTGCCCAAAGTAAAAATGG - Intergenic
925591405 2:5513411-5513433 CAGCTTTTCCTGAGGAAGAAGGG + Intergenic
926897432 2:17709629-17709651 GTGCTGTTCCAGAGGATAAAGGG + Intronic
927579604 2:24230410-24230432 CTGCCTTGCCAGATTAAAGAGGG - Intronic
927692914 2:25220996-25221018 CACCTTGTCCAGACTAAAAAAGG + Intergenic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
928897476 2:36281701-36281723 CAGATTTTGCAGAGTAAGAAGGG - Intergenic
929170821 2:38931610-38931632 CTGGTTTTCCAGAGAAAGACAGG - Intronic
929786817 2:44999386-44999408 TGGCTATTCCAGAGTAAAGATGG - Intergenic
930330125 2:49972670-49972692 TTGCTTTACCAGATTACAAATGG - Intronic
931179984 2:59889960-59889982 CTCCTCCTCCAGAGTAACAAGGG - Intergenic
931307287 2:61042232-61042254 CTGCTTTTCCACTGTAACAGTGG + Intronic
931431856 2:62214825-62214847 CTGGTTTTCCAGTCTGAAAATGG + Intronic
931484510 2:62676671-62676693 CTGCTTTTCCAGCAAAACAATGG - Intronic
932046469 2:68355619-68355641 CTGCTTTTGTAGTGTGAAAATGG + Intergenic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
934872686 2:97881568-97881590 CTCCTGTTACAGAGTAAAACTGG + Intronic
937496376 2:122424657-122424679 CTGCCTTTCCAGGGAAAGAAAGG + Intergenic
938189998 2:129269956-129269978 CTGCTATTACAGAGTTATAAAGG + Intergenic
938955373 2:136292997-136293019 CTACATTTCCAGAGAGAAAAAGG + Intergenic
939477800 2:142708676-142708698 CTCATTTTCCTGATTAAAAATGG + Intergenic
940014198 2:149086389-149086411 CTGCTCTTCCAGACTGAAGAAGG + Intronic
940123631 2:150296923-150296945 GTGCTTTCCCAGAGATAAAAAGG + Intergenic
942145940 2:173026240-173026262 CTTCTTTTCCCTGGTAAAAATGG - Intronic
943264460 2:185709854-185709876 CTGCTGTGCCAAGGTAAAAAGGG + Intergenic
945367193 2:208969279-208969301 CTACTTCTCCAGGGTATAAATGG + Intergenic
948042081 2:234910518-234910540 CTGCTATTCCAGACTCAAGAAGG - Intergenic
948345336 2:237291737-237291759 CTGCTTTTCAAAGATAAAAATGG - Intergenic
948538572 2:238667848-238667870 TTGCTTTACCAGATGAAAAATGG - Intergenic
1169774593 20:9238607-9238629 GTGATTTTCCAGAGCATAAAAGG + Intronic
1170157431 20:13281386-13281408 CTGCTTTCCAAGAGGAAAGACGG + Intronic
1170512691 20:17095098-17095120 CTGCTTCTCAACAGTAATAAAGG - Intergenic
1170823694 20:19775637-19775659 CTGTTTTTCCAGTGTAAATTGGG - Intergenic
1180907921 22:19428628-19428650 CTGTTTTTCGAGAGTCTAAAGGG - Intronic
1180922374 22:19527539-19527561 CTGCTTTCCCAGGGGAAGAATGG + Exonic
1181362259 22:22346980-22347002 CTGCTTTTAAAAAATAAAAATGG - Intergenic
1182194362 22:28499511-28499533 TTTTTTTTCCAGAGGAAAAAAGG - Intronic
952598871 3:35054482-35054504 CTTCTTTTCAATATTAAAAATGG + Intergenic
954159469 3:48710499-48710521 GTTATTTTCCAAAGTAAAAACGG + Intronic
954332375 3:49897905-49897927 CTGCTTTTTGAGAGTCAAAAAGG - Intronic
954343523 3:49975204-49975226 TTGCTTTTCCAAAGTAATCATGG + Intronic
954799690 3:53180153-53180175 CTGCCTTTCCAAAATTAAAAAGG - Intronic
955540835 3:59974319-59974341 CTTATTTTCCAAAGTAAAAATGG + Intronic
955544681 3:60015565-60015587 CTGCTTTTTCTGTGTTAAAAGGG + Intronic
955976914 3:64488756-64488778 CTGCTTTTACAGAGGAAGAAAGG - Intergenic
956256370 3:67287232-67287254 TTTCTTTTCCACAGTAAAACTGG - Intergenic
959800662 3:110491252-110491274 ATGCTTTTCAAGATGAAAAAAGG - Intergenic
960620143 3:119629372-119629394 CTTCTCTTCCAGAGAAAAGATGG + Exonic
960826768 3:121795063-121795085 CTGATTTTCCTGAATAAATATGG - Intronic
961116284 3:124332784-124332806 CTGCTTTTCAGGAGAAAGAAAGG + Intronic
961424842 3:126836908-126836930 CTGCTCTTCCTGAGGAGAAATGG + Intronic
962010659 3:131387381-131387403 TTGCTTTTCGAGTGTAAGAAGGG - Intronic
965722510 3:171677222-171677244 CTGCATTTCCAGCGTTAGAATGG - Intronic
965787941 3:172356057-172356079 CTCCTTTTGCTAAGTAAAAAAGG + Intronic
966036048 3:175416589-175416611 CTTCTTCTCCAAAGTAAAAAAGG - Intronic
966181205 3:177190279-177190301 CTACTATTCCAGAATTAAAAGGG + Intronic
966373119 3:179268850-179268872 CTGCTTTTCCAGAGTAAAAAGGG + Intergenic
966704537 3:182896372-182896394 TTGCTGTTGCACAGTAAAAATGG - Intronic
968166453 3:196469850-196469872 CTGCTATTCCAGAAAAAAATGGG - Exonic
969347435 4:6578260-6578282 CTGCTTTTATAGAGTAAGCAAGG + Intronic
970743585 4:19267166-19267188 CTGCTTTACCTCAGGAAAAAAGG - Intergenic
971021529 4:22541386-22541408 CTGCTTTTCAAGGATAACAATGG - Intergenic
971386905 4:26149133-26149155 CAGTTTTTCCAGAGTCATAAGGG + Intergenic
971670849 4:29555273-29555295 CTACTGTTCAAGAGGAAAAATGG + Intergenic
971967801 4:33583923-33583945 CTGCTCTTGCAGAGTACAAATGG + Intergenic
972411109 4:38795777-38795799 CTGGTTGTCCACAGTAGAAATGG - Intronic
972429469 4:38966590-38966612 ATGCTTTTCCAGAGTTAAGGTGG - Intergenic
972980333 4:44691656-44691678 CTGCTCTTCGAGCCTAAAAAGGG - Exonic
974176056 4:58326586-58326608 ATGCTTTTCTAGAGTAACGATGG + Intergenic
975186898 4:71414012-71414034 CTGCTTTTTCAGTGCAAAGATGG + Intronic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
978263910 4:106799073-106799095 CTCCTTTTAAAGAGTAATAAAGG + Intergenic
978270307 4:106881509-106881531 GTGATTTTCCACAGGAAAAATGG + Intergenic
978346269 4:107773422-107773444 CTGCTTTTCTACAATTAAAAAGG - Intergenic
980617905 4:135256578-135256600 CTGCTATTCCAGAGGACACAAGG - Intergenic
980929598 4:139172929-139172951 ATACTATTCCAAAGTAAAAAGGG + Intronic
981563958 4:146078283-146078305 TTGATTTTCCTGAGTAGAAAAGG + Intergenic
981799509 4:148638707-148638729 CTGCTTTCCCAGAGTAACCTTGG - Intergenic
983882271 4:172946858-172946880 CTGCTTTTCCATAACCAAAATGG - Intronic
984592996 4:181637170-181637192 CTAATTTTGCAGAGGAAAAAAGG - Intergenic
984626257 4:182010541-182010563 CTGATTTTTCAAAGAAAAAATGG + Intergenic
984835555 4:184016632-184016654 CTGCTAATCCAGAATGAAAATGG + Intronic
987654512 5:20788832-20788854 TGGCTTTCCCAGATTAAAAATGG - Intergenic
988741125 5:34072975-34072997 TGGCTTTCCCAGATTAAAAATGG + Intronic
990132486 5:52604057-52604079 CTGTTTTTTATGAGTAAAAATGG - Intergenic
990319831 5:54618961-54618983 TTGCTTTTTTAGAGTTAAAAAGG - Intergenic
992272392 5:75078433-75078455 ATGCTTTTCCAGAAAAAAATAGG - Intronic
993810282 5:92467756-92467778 TTACTTTTCCTCAGTAAAAATGG - Intergenic
994541740 5:101108318-101108340 CTGCTGTCCCACAGAAAAAAGGG + Intergenic
995878187 5:116814216-116814238 CTGCCTTCCCAAAGTAAGAAGGG + Intergenic
996209435 5:120787861-120787883 CTACTTTTACATAGTATAAAAGG + Intergenic
996546805 5:124688034-124688056 CTGCTTTTTCAGAATAAAGAAGG - Intronic
996891796 5:128429096-128429118 CTGCGTTTCCAGAGTTTGAAAGG - Intronic
997191221 5:131937651-131937673 CTGATTTTGCAGAGTCAAAATGG - Intronic
998807405 5:145932267-145932289 CTGCCTTCCCAGAGGATAAAAGG + Intergenic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
1000387310 5:160687054-160687076 CTGCATTACCTGAGTGAAAAGGG - Intronic
1001439157 5:171725481-171725503 CTCCTTTTCCAGATTAAAGAAGG - Intergenic
1001729989 5:173945963-173945985 CTTCGTTTCCTGAGTGAAAATGG + Intronic
1001973393 5:175976147-175976169 CTGCTTTTACAGAAATAAAAAGG + Intronic
1002244044 5:177867636-177867658 CTGCTTTTACAGAAATAAAAAGG - Intergenic
1005424764 6:25691044-25691066 TTTCTTTTTCAGAGTAAAACAGG + Exonic
1006050223 6:31336525-31336547 CTGCTTTCCCAGAGGAAATTAGG + Intronic
1006704345 6:36004965-36004987 CTGCTTTTCAAGAGTAAATGGGG - Intronic
1007219097 6:40264504-40264526 CTGATTTTATAGAGTAGAAAGGG + Intergenic
1010727012 6:79346759-79346781 CTTCTTTTGGAGAGTAGAAATGG - Intergenic
1010853802 6:80812766-80812788 CTGGTTCTCCAGCATAAAAAAGG - Intergenic
1010981113 6:82371054-82371076 CTGGTTTTCCAGGGTGATAATGG - Intergenic
1011599508 6:89046925-89046947 CTTCTTTTCCAGAGTTGAGAGGG - Intergenic
1011650074 6:89497516-89497538 CTGCTTTTCCACAATAATAGGGG + Intronic
1012067579 6:94568074-94568096 CATCTTTTCCAGAGAAAAATGGG - Intergenic
1012810323 6:103948697-103948719 CTGCTTTTCCAGAGCAAGCTTGG + Intergenic
1013980810 6:116126430-116126452 GTGCTTTTCAAAAATAAAAAGGG - Intronic
1014156656 6:118118397-118118419 CTGATTTTCCATGGTAACAAGGG - Intronic
1014819875 6:125975907-125975929 CTGCTTTTCCAAAGCAAAAGTGG + Intronic
1015314199 6:131798551-131798573 CAGTTTTTCAGGAGTAAAAATGG - Intergenic
1016560755 6:145393090-145393112 CTGCTTGACCAGAGTACTAAAGG - Intergenic
1016797028 6:148129297-148129319 CTGTTATTCCAGAGGAAAATAGG + Intergenic
1017252265 6:152293444-152293466 CAGTTCTTCCAGAGTAAACAAGG - Intronic
1021112594 7:16712656-16712678 CTACTTTTCCAGAGAAGACACGG - Intergenic
1021171074 7:17398587-17398609 TTGCTTTTCCTGGGTAAAACAGG + Intergenic
1023720526 7:43089001-43089023 CTGCTGCTCCAGGGTAAGAAGGG + Intergenic
1027433388 7:78137302-78137324 CTGTTTTTCGACAGTAAAATTGG + Intronic
1027487822 7:78783983-78784005 CTTTTTTTCCTGATTAAAAAAGG - Intronic
1028053441 7:86212654-86212676 ATGATTTTCCAGAAAAAAAATGG + Intergenic
1029107137 7:98187207-98187229 CTGCTTTTCTAAAGGAAAATGGG - Intronic
1030328083 7:108242946-108242968 ATGCTTTTTCAGAGTATACATGG + Intronic
1031048607 7:116921908-116921930 GTGCTTTTCCAGAGTACACTTGG + Exonic
1031692499 7:124806965-124806987 TTGTTTTTCAAAAGTAAAAAGGG - Intergenic
1033439773 7:141367989-141368011 CTGCTCTTCCAGAATAAGCATGG - Intronic
1035818264 8:2563446-2563468 CAGCTTTCCCAGGGTAAAATGGG + Intergenic
1036649334 8:10632326-10632348 CTCCATTTCCAGAGGAGAAAAGG - Intronic
1036971353 8:13358910-13358932 TTGCTTTTGCAGAATAAAATAGG - Intronic
1038482506 8:27911381-27911403 CTGCTTTTCAAGAGAAAACAAGG + Intronic
1038525941 8:28273417-28273439 CTGGCTTTCCAGAGAAAATATGG + Intergenic
1040673578 8:49722002-49722024 CTGCTTTTCTAGATCAGAAATGG - Intergenic
1040714986 8:50240211-50240233 CTGCATTTCAGGAGCAAAAATGG - Intronic
1045200770 8:99978518-99978540 GAGCTTTTCCAGAGGCAAAATGG - Intronic
1045309997 8:100992960-100992982 CTGCTTTTACAGAAATAAAATGG - Intergenic
1045430118 8:102105859-102105881 CTGCTCCTCCATAGTAAAATGGG + Intronic
1045845006 8:106624084-106624106 CTGACTTTCCAGAGAAACAAGGG - Intronic
1045865593 8:106862023-106862045 CAACTTTTCCAAAGCAAAAATGG + Intergenic
1047547483 8:125833166-125833188 CTGCTTACGCAGAGTAAAGAGGG - Intergenic
1047588366 8:126299556-126299578 GTGGTTTTCCAGAGGAAAACAGG + Intergenic
1048492965 8:134911805-134911827 CTGATTTTCCAGAGGAGAGAAGG + Intergenic
1048583737 8:135753067-135753089 CTGCTATTACAGAGAACAAAGGG - Intergenic
1049979286 9:889357-889379 CTGCTCTTCCAAAGTTCAAATGG + Intronic
1051210830 9:14741301-14741323 CTGCTTTTCCAGACTAGATATGG + Intronic
1051310164 9:15762312-15762334 CTCCTTTTCCAGAAAAAATATGG + Intronic
1052176617 9:25471118-25471140 CTGGTTTTCTAGATTAAAACAGG - Intergenic
1054946302 9:70799513-70799535 CTCCTTTTCCAGAGGAAAGAAGG - Intronic
1055413469 9:76056674-76056696 ATGCTCTTCAAGAGTTAAAATGG + Intronic
1055636869 9:78287588-78287610 CTGCTTTTCATGAGAAAACAAGG + Intergenic
1057111933 9:92480327-92480349 CTGCTTTTTCTCAGTAAAAGAGG - Intronic
1057741308 9:97714417-97714439 CTGCTTTTCCTCTGTAAAATGGG - Intergenic
1057921523 9:99102210-99102232 CTGCTTTCCCAAAGAAAAACAGG + Intergenic
1059260450 9:112971049-112971071 CTGCTTTCCCAGAAGAAAAATGG - Intergenic
1059594037 9:115696687-115696709 CCTCTTTACCTGAGTAAAAATGG - Intergenic
1060213876 9:121726731-121726753 CTGCTTTGTGAGAGTATAAAAGG + Intronic
1061626879 9:131845799-131845821 CTGCTTTTCTTGACTAAAGATGG + Intergenic
1062275578 9:135728812-135728834 GAGCTGTTCCAGATTAAAAAGGG - Intronic
1185774117 X:2788456-2788478 ATGCTTTTCCAGATGACAAATGG + Intronic
1185863272 X:3599374-3599396 CTGCTTTTCCACATTAAAACGGG - Intergenic
1187488497 X:19727139-19727161 ATGCTTTACCACAATAAAAAAGG - Intronic
1187815309 X:23225272-23225294 CTACTGTTCCAGAGTTACAATGG - Intergenic
1188277957 X:28224337-28224359 CTGCTTTTGCAAAGTAAAAGAGG + Intergenic
1190394039 X:49961712-49961734 CTGCTTCTCAAGAGAAAACAAGG - Intronic
1191166028 X:57393111-57393133 CTGCCTTTCCAGAGAACAGAGGG - Intronic
1195105157 X:101596451-101596473 CTGCTTTCCCAGAGCCATAAAGG - Intergenic
1197729374 X:129796900-129796922 CTCCTTTTCTAAAATAAAAATGG - Intergenic
1199239990 X:145535361-145535383 CTGGTTCTCCAGAAAAAAAAAGG + Intergenic
1199621434 X:149705119-149705141 CAGCTTTTCCTGAGCAAATAAGG - Intronic
1199969952 X:152852431-152852453 CTGCCTGTCCAGAGTAGCAAGGG + Intronic
1200204170 X:154303938-154303960 GTGATTTTCCAAAGTAGAAAGGG + Intronic
1201560901 Y:15315469-15315491 TTGATTTTTCAGAGCAAAAAGGG + Intergenic